Stem-loop bta-mir-129-2

Accession

MI0009729

Description

Bos taurus bta-mir-129-2 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Bta-mir-129 is a bovine miRNA that has been studied in various contexts. In one study, it was among the miRNAs assessed in both murine and bovine samples [PMC9188571]. Another study found that bta-mir-129 was one of the miRNAs involved in the regulation of IGF-1 expression, along with other circRNAs and miRNAs [PMC9821774]. Specifically, bta-mir-129 and a circRNA called novel_circ_016821 were identified as the main regulatory factors [PMC9821774]. In a different study, bta-mir-129 was found to be increased at day 7 of the estrous cycle compared to day 3 [PMC4156418]. Additionally, it was up-regulated in pregnant cows but not detected across the estrous cycle [PMC7969882]. Finally, at parturition, bta-mir-129 was part of a group of miRNAs that showed time-dependent expression patterns, with some being overexpressed and others being downregulated [PMC9445238]. These findings highlight the involvement of bta-mir-129 in various biological processes and its potential as a biomarker or therapeutic target.

Literature search

6 open access papers mention bta-mir-129-2
(14 sentences)

Sequence

1429 reads, 70 reads per million, 64 experiments

cugcccuucgcgaauCUUUUUGCGGUCUGGGCUUGCUguacauaacucaauagccggAAGCCCUUACCCCAAAAAGCAUucgcggagggcgcac
.(((((((((((((((((((((.(((..(((((((((((..........)))))...))))))..))).))))))).))))))))))))))...

Structure

--c              -       C   CU      ---     acau 
   ugcccuucgcgaau CUUUUUG GGU  GGGCUU   GCUgu    a
   |||||||||||||| ||||||| |||  ||||||   |||||     
   gcgggaggcgcuUA GAAAAAC CCA  CCCGAA   cgaua    a
cac              C       C   UU      ggc     acuc 

Annotation confidence High

Genome context

chr15: 74898231-74898324 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from bta-mir-129-2

Mature bta-miR-129-5p

• Accession: MIMAT0009221
• Description: Bos taurus bta-miR-129-5p mature miRNA
• Sequence: 16 - CUUUUUGCGGUCUGGGCUUGCU - 37
• Evidence: experimental ; cloned [3]

Mature bta-miR-129-3p

• Accession: MIMAT0009222
• Description: Bos taurus bta-miR-129-3p mature miRNA
• Sequence: 58 - AAGCCCUUACCCCAAAAAGCAU - 79
• Evidence: experimental ; cloned [3]

References

1. PubMed ID: 18215311
   miRNAminer: a tool for homologous microRNA gene search
   "Artzi S, Kiezun A, Shomron N"
   "BMC Bioinformatics (2008) 9:39


2. PubMed ID: 19758457
   Characterization of bovine miRNAs by sequencing and bioinformatics analysis
   Jin W, Grant JR, Stothard P, Moore SS, Guan LL
   BMC Mol Biol (2009) 10:90


3. PubMed ID: 18945293
   Annotation of 390 bovine miRNA genes by sequence similarity with other species
   "Strozzi F, Mazza R, Malinverni R, Williams JL"
   "Anim Genet (2009) 40:125