bta-mir-92a, a microRNA, has been identified as a potential diagnostic marker in animals exposed to certain pathogens, with its expression being lower in the positive group compared to the negative group [PMC4990326]. This microRNA has been found to be highly expressed in bovine skeletal muscle and is among the most abundant miRNAs expressed across various samples [PMC4410957], [PMC4156418], [PMC6107498]. It is also considered immune-related and is consistently present among the top expressed miRNAs, suggesting a role in cattle immune response and development [PMC6940744]. Misregulation of bta-mir-92a has been observed in liver affected by LOS and its expression varies in extracellular vesicles (EVs) from embryos at different developmental stages, indicating its involvement in embryonic development [PMC6691986], [PMC7727673], [PMC8060439]. Furthermore, bta-mir-92a is implicated as a potential biomarker for pregnancy and has shown regulated expression levels during this state [PMC5325256]. Its dominant expression has also been reported in dairy cows' blood exosomes, highlighting its significance across various physiological conditions and developmental stages within cattle [PMC9445238].
-cuuu ac c u uu
cu acagguugggau ggu gcaaugcugug u
|| |||||||||||| ||| |||||||||||
ga UGUCCGGCCCUG UCA CGUUAUgguau c
gguuu gu U - gu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0009383 |
| Description | Bos taurus bta-miR-92a mature miRNA |
| Sequence | 48 - UAUUGCACUUGUCCCGGCCUGU - 69 |
| Evidence |
experimental
cloned [2] |
|