Stem-loop osa-MIR827

Accession

MI0010490

Description

Oryza sativa osa-MIR827 precursor miRNA

Literature search

24 open access papers mention osa-MIR827
(69 sentences)

Sequence

684 reads, 478 reads per million, 2 experiments

uuuuguugcuggucaucuagcuacccgugcaugccuggagauuggagaauaauugacgaugcagcagucggcuuauuggcucuugggcacgcguggUUAGAUGACCAUCAGCAAACA
.(((((((.(((((((((((((((.(((((...((.((((.......((((((((((.........))))).)))))..)))).))))))).))))))))))))))).)))))))..

Structure

-u       c               c     aug  u    auuggag     -     gau 
  uuuguug uggucaucuagcuac cgugc   cc ggag       aauaa uugac   g
  ||||||| ||||||||||||||| |||||   || ||||       ||||| |||||   c
  AAACGAC ACCAGUAGAUUggug gcacg   gg ucuc       uuauu ggcug   a
AC       U               c     ---  u    -----gg     c     acg 

Annotation confidence Not enough data

Genome context

Unknown

Mature osa-miR827

• Accession: MIMAT0009981
• Description: Oryza sativa osa-miR827 mature miRNA
• Sequence: 97 - UUAGAUGACCAUCAGCAAACA - 117
• Evidence: experimental ; cloned [1], Illumina [2]

References

1. PubMed ID: 19055717
   Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice
   Lacombe S, Nagasaki H, Santi C, Duval D, Piégu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M
   BMC Plant Biol (2008) 8:123


2. PubMed ID: 19103661
   Characterization and expression profiles of miRNAs in rice seeds
   "Xue LJ, Zhang JJ, Xue HW"
   "Nucleic Acids Res (2009) 37:916-930