Stem-loop mtr-MIR2597

Accession

MI0011834

Description

Medicago truncatula mtr-MIR2597 precursor miRNA

Literature search

1 open access papers mention mtr-MIR2597
(1 sentences)

Sequence

uugaagacgaaucuugaucuaucgacgaaguaucaaaugagauagaaaucauuuugauuuuauauuaUUUGGUACUUCGUCGAUUUGAuuaaaauucgauauuucau
.(((((.(((((.((((((.((((((((((((((((((((....(((((((...)))))))...))))))))))))))))))))..)))))).)))))...))))).

Structure

u     --a     c      -u                    gaua       u 
 ugaag   cgaau uugauc  aucgacgaaguaucaaauga    gaaauca  
 |||||   ||||| ||||||  ||||||||||||||||||||    ||||||| u
 acuuu   gcuua aauuAG  UAGCUGCUUCAUGGUUUauu    uuuuagu  
u     aua     a      UU                    -aua       u 

Annotation confidence Low

Genome context

chr6: 18776013-18776119 [-]

References

1. PubMed ID: 19767456
   Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules
   "Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M"
   "Plant Cell (2009) 21:2780-2796


2. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553