miRBase entry: mtr-MIR2597

Stem-loop mtr-MIR2597


Accession
MI0011834
Description
Medicago truncatula mtr-MIR2597 precursor miRNA

Literature search
1 open access papers mention mtr-MIR2597
(1 sentences)

Sequence


uugaagacgaaucuugaucuaucgacgaaguaucaaaugagauagaaaucauuuugauuuuauauuaUUUGGUACUUCGUCGAUUUGAuuaaaauucgauauuucau
.(((((.(((((.((((((.((((((((((((((((((((....(((((((...)))))))...))))))))))))))))))))..)))))).)))))...))))).

Structure
u     --a     c      -u                    gaua       u 
 ugaag   cgaau uugauc  aucgacgaaguaucaaauga    gaaauca  
 |||||   ||||| ||||||  ||||||||||||||||||||    ||||||| u
 acuuu   gcuua aauuAG  UAGCUGCUUCAUGGUUUauu    uuuuagu  
u     aua     a      UU                    -aua       u 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr6: 18776013-18776119 [-]

Database links


References

  1. PubMed ID: 19767456
    Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules
    "Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M"
    "Plant Cell (2009) 21:2780-2796

  2. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553