miRBase entry: aae-mir-277

Stem-loop aae-mir-277


Accession
MI0013435
Description
Aedes aegypti aae-mir-277 precursor miRNA

Literature search
1 open access papers mention aae-mir-277
(1 sentences)

Sequence

18778 reads, 955 reads per million, 2 experiments
uaguuuuggagugCGUGUCAGAAGUGCAUUUACAuagguauuucccguuuagcaguauuugUAAAUGCACUAUCUGGUACGACauuccagaauca
..((((((((((((((((((((((((((((((((..((((((.(.......).)))))))))))))))))).))))))))).)))))))))))..

Structure
ua           -         -            ua      u cc 
  guuuuggagug CGUGUCAGA AGUGCAUUUACA  gguauu c  g
  ||||||||||| ||||||||| ||||||||||||  |||||| |  u
  uaagaccuuaC GCAUGGUCU UCACGUAAAUgu  uuauga g  u
ac           A         A            --      c au 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
supercont1.265: 508799-508893 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from aae-mir-277
Name Accession Chromosome Start End Strand Confidence




Database links

Mature aae-miR-277-5p

Accession MIMAT0014210
Description Aedes aegypti aae-miR-277-5p mature miRNA
Sequence 14 - CGUGUCAGAAGUGCAUUUACA - 34
Evidence experimental
Illumina [2]

Mature aae-miR-277-3p

Accession MIMAT0014211
Description Aedes aegypti aae-miR-277-3p mature miRNA
Sequence 62 - UAAAUGCACUAUCUGGUACGAC - 83
Evidence experimental
454 [1], Illumina [2]

References

  1. PubMed ID: 19961592
    Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs
    Li S, Mead EA, Liang S, Tu Z
    BMC Genomics (2009) 10:581

  2. PubMed ID: 20167119
    Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus
    Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR
    BMC Genomics (2010) 11:119