miRBase entry: aae-mir-252

Stem-loop aae-mir-252


Accession
MI0013438
Description
Aedes aegypti aae-mir-252 precursor miRNA

Literature search
3 open access papers mention aae-mir-252
(6 sentences)

Sequence

49219 reads, 2549 reads per million, 2 experiments
gaauucuuuacUAAGUACUAGUGCCGCAGGAGagauuugaacccCUGCUGCCCAAGUGCUUAUCGaagagu
..(((((((..((((((((.(.((.(((((.............))))).)).).))))))))..)))))))

Structure
ga       ac        A U  C     AGaga 
  auucuuu  UAAGUACU G GC GCAGG     u
  |||||||  |||||||| | || |||||     u
  ugagaaG  AUUCGUGA C CG CGUCc     u
--       CU        A C  U     ccaag 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
supercont1.56: 1580021-1580091 [-]

Database links

Mature aae-miR-252-5p

Accession MIMAT0014216
Description Aedes aegypti aae-miR-252-5p mature miRNA
Sequence 12 - UAAGUACUAGUGCCGCAGGAG - 32
Evidence experimental
454 [1], Illumina [2]

Mature aae-miR-252-3p

Accession MIMAT0014217
Description Aedes aegypti aae-miR-252-3p mature miRNA
Sequence 45 - CUGCUGCCCAAGUGCUUAUCG - 65
Evidence experimental
454 [1], Illumina [2]

References

  1. PubMed ID: 19961592
    Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs
    Li S, Mead EA, Liang S, Tu Z
    BMC Genomics (2009) 10:581

  2. PubMed ID: 20167119
    Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus
    Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR
    BMC Genomics (2010) 11:119