miRBase entry: aae-mir-993

Stem-loop aae-mir-993


Accession
MI0013472
Description
Aedes aegypti aae-mir-993 precursor miRNA


Sequence

17009 reads, 862 reads per million, 2 experiments
agcgcuccuccgugaccUACCCUGUAGUUCCGGGCUUUUgugguuucuuuuauuguuaauuaucagaagcucguuucuauagagguaucucacagggugaa
..(((.(((..((((..((((((((((...(((((((((((((((............))))).))))))))))...)))))).))))..))))))))))..

Structure
ag   u   cc    cc    -      UUC          -     ucuuu 
  cgc ccu  guga  UACC CUGUAG   CGGGCUUUUg ugguu     u
  ||| |||  ||||  |||| ||||||   |||||||||| |||||      
  gug gga  cacu  augg gauauc   gcucgaagac auuaa     a
aa   -   --    cu    a      uuu          u     uuguu 


Annotation confidence Low
Do you think this miRNA is real?
Comments
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
supercont1.1056: 256781-256881 [+]

Database links

Mature aae-miR-993

Accession MIMAT0014266
Description Aedes aegypti aae-miR-993 mature miRNA
Sequence 18 - UACCCUGUAGUUCCGGGCUUUU - 39
Evidence experimental
454 [1], Illumina [2]

References

  1. PubMed ID: 19961592
    Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs
    Li S, Mead EA, Liang S, Tu Z
    BMC Genomics (2009) 10:581

  2. PubMed ID: 20167119
    Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus
    Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR
    BMC Genomics (2010) 11:119