miRBase entry: aae-mir-263a

Stem-loop aae-mir-263a


Accession
MI0013495
Description
Aedes aegypti aae-mir-263a precursor miRNA

Literature search
3 open access papers mention aae-mir-263a
(9 sentences)

Sequence

204461 reads, 10483 reads per million, 2 experiments
uccuaguacacguAAUGGCACUGGAAGAAUUCACGGguauauuuugaaaucccCGUGUUCUGGCAGUGGCAUCCCugguacuaaggugauucaucag
.((((((((..(..(((.(((((..((((..((((((.((........)).))))))))))..))))).)))..)..))))).)))...........

Structure
----------u   -     ac uA   G     GA    UU      u  auu 
           ccu aguac  g  AUG CACUG  AGAA  CACGGg au   u
           ||| |||||  |  ||| |||||  ||||  |||||| ||    
           gga ucaug  C  UAC GUGAC  UCUU  GUGCcc ua   u
gacuacuuagu   a     gu CC   G     GG    --      c  aag 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
supercont1.981: 164938-165034 [-]

Database links

Mature aae-miR-263a-5p

Accession MIMAT0014289
Description Aedes aegypti aae-miR-263a-5p mature miRNA
Sequence 14 - AAUGGCACUGGAAGAAUUCACGG - 36
Evidence experimental
454 [1]

Mature aae-miR-263a-3p

Accession MIMAT0015372
Description Aedes aegypti aae-miR-263a-3p mature miRNA
Sequence 54 - CGUGUUCUGGCAGUGGCAUCCC - 75
Evidence experimental
454 [1]

References

  1. PubMed ID: 19961592
    Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs
    Li S, Mead EA, Liang S, Tu Z
    BMC Genomics (2009) 10:581

  2. PubMed ID: 20167119
    Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus
    Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR
    BMC Genomics (2010) 11:119