miRBase entry: hsa-mir-3138

Stem-loop hsa-mir-3138


Accession
MI0014161
Symbol
HGNC: MIR3138
Description
Homo sapiens hsa-mir-3138 precursor miRNA mir-3138
Gene
family?
RF03837; mir-3138

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR3138 is a microRNA that has been validated through pyrosequencing and RT-PCR to undergo changes in methylation and exhibit a trend for decreased gene expression in degenerating sural nerves in diabetic peripheral neuropathy (DPN) [PMC6615525]. The gene ERBB4, which is associated with sensory nerve loss and nerve regeneration, has been identified as a target of MIR3138, suggesting a regulatory role for this microRNA in nerve degeneration and regeneration in DPN [PMC6615525]. Differential methylation of MIR3138, confirmed by RRBS and pyrosequencing, is associated with its decreased expression and may contribute to the progression of DPN [PMC6615525]. Primers for MIR3138 were designed, and pyrosequencing amplicons were prepared to validate its differential methylation, which was found to be the most significant among miRNAs between degenerating and regenerating nerves [PMC6615525]. Additionally, MIR3138 has been implicated in tumor suppression, indicating its broader significance in cellular processes [PMC6615525].

Literature search
4 open access papers mention hsa-mir-3138
(16 sentences)

Sequence

557 reads, 5 reads per million, 53 experiments
cccuccucggcacuucccccaccucacugcccgggugcccacaagacUGUGGACAGUGAGGUAGAGGGAGUgccgaggaggg
(((((((((((((((((.(.((((((((((((((............))).)).))))))))).).)))))))))))))))))

Structure
                 c c         -  -   gugcc 
cccuccucggcacuucc c accucacug cc cgg     c
||||||||||||||||| | ||||||||| || |||      
gggaggagccgUGAGGG G UGGAGUGAC GG GUc     a
                 A A         A  U   agaac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 10078611-10078692 [-]

Database links

Mature hsa-miR-3138

Accession MIMAT0015006
Description Homo sapiens hsa-miR-3138 mature miRNA
Sequence 48 - UGUGGACAGUGAGGUAGAGGGAGU - 71
Evidence experimental
Illumina [1-2]
Database links
Predicted targets

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 20224791
    Discovery of novel microRNAs in female reproductive tract using next generation sequencing
    Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH
    PLoS One (2010) 5:e9637