MIR3138 is a microRNA that has been validated through pyrosequencing and RT-PCR to undergo changes in methylation and exhibit a trend for decreased gene expression in degenerating sural nerves in diabetic peripheral neuropathy (DPN) [PMC6615525]. The gene ERBB4, which is associated with sensory nerve loss and nerve regeneration, has been identified as a target of MIR3138, suggesting a regulatory role for this microRNA in nerve degeneration and regeneration in DPN [PMC6615525]. Differential methylation of MIR3138, confirmed by RRBS and pyrosequencing, is associated with its decreased expression and may contribute to the progression of DPN [PMC6615525]. Primers for MIR3138 were designed, and pyrosequencing amplicons were prepared to validate its differential methylation, which was found to be the most significant among miRNAs between degenerating and regenerating nerves [PMC6615525]. Additionally, MIR3138 has been implicated in tumor suppression, indicating its broader significance in cellular processes [PMC6615525].
                                             c c         -  -   gugcc 
cccuccucggcacuucc c accucacug cc cgg     c
||||||||||||||||| | ||||||||| || |||      
gggaggagccgUGAGGG G UGGAGUGAC GG GUc     a
                 A A         A  U   agaac 
            | Accession | MIMAT0015006 | 
| Description | Homo sapiens hsa-miR-3138 mature miRNA | 
| Sequence | 48 - UGUGGACAGUGAGGUAGAGGGAGU - 71 | 
| Evidence | 
                                    experimental
                                    
                                     Illumina [1-2]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                 
                                       
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                
                                        
                                     | 
                                
                        
  |