WARNING: This summary was generated by AI. MIR3138 is a microRNA that has been validated through pyrosequencing and RT-PCR to undergo changes in methylation and exhibit a trend for decreased gene expression in degenerating sural nerves in diabetic peripheral neuropathy (DPN) [PMC6615525]. The gene ERBB4, which is associated with sensory nerve loss and nerve regeneration, has been identified as a target of MIR3138, suggesting a regulatory role for this microRNA in nerve degeneration and regeneration in DPN [PMC6615525]. Differential methylation of MIR3138, confirmed by RRBS and pyrosequencing, is associated with its decreased expression and may contribute to the progression of DPN [PMC6615525]. Primers for MIR3138 were designed, and pyrosequencing amplicons were prepared to validate its differential methylation, which was found to be the most significant among miRNAs between degenerating and regenerating nerves [PMC6615525]. Additionally, MIR3138 has been implicated in tumor suppression, indicating its broader significance in cellular processes [PMC6615525].
C C - - gugcc
cccuccucggcACUUCC C ACCUCACUG CC Cgg c
||||||||||||||||| | ||||||||| || |||
gggaggagcCGUGAGGG G UGGAGUGAC gg guc a
A A A u agaac
| Accession | MIMAT0050560 |
| Description | Homo sapiens hsa-miR-3138-5p mature miRNA |
| Sequence | 12 - ACUUCCCCCACCUCACUGCCC - 32 |
| Evidence |
experimental
Illumina [1-2] |
| Accession | MIMAT0015006 |
| Description | Homo sapiens hsa-miR-3138-3p mature miRNA |
| Sequence | 53 - ACAGUGAGGUAGAGGGAGUGC - 73 |
| Evidence |
experimental
Illumina [1-2] |
| Database links |
|
| Predicted targets |
|
|