MIR3158-1 is a microRNA implicated in split-hand/foot malformation (SHFM), a congenital limb disorder [PMC5003447]. In SHFM cases, duplications often include MIR3158-1, alongside genes such as BTRC, POLL, DPCD, and FBXW4 [PMC5003447]. Specifically, MIR3158-1 is part of the shortest duplicated region identified in patients without microarray data and is consistently duplicated in the majority of SHFM cases [PMC5003447]. The duplication patterns involving MIR3158-1 vary; some patients have continuous duplications while others have two discontinuous duplications at the 10q24.31–q24.32 locus [PMC5003447'>PMC5003447]. In one instance, a patient with atypical SHFM features harbored a 241.59 kb duplication at 10q24.31-q24.32 that included MIR3158-1 [PMC5003447]. This suggests that duplications involving MIR3158-1 may contribute to a broader spectrum of phenotypes beyond classical SHFM presentations [PMC5003447].
                                  ---   u 
auucaggccgguCCUGCAGAGAGGAAGCCCUUCu   gcu a
||||||||||||||||||||||||||||||||||   |||  
uaaguccggcCAGGACGUCUCUCCUUCGGGAAgg   ugg c
                                  uua   a 
            | Name | Accession | Chromosome | Start | End | Strand | Confidence | 
|---|
| Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0015032 | 
| Description | Homo sapiens hsa-miR-3158-3p mature miRNA | 
| Sequence | 50 - AAGGGCUUCCUCUCUGCAGGAC - 71 | 
| Evidence | 
                                    experimental
                                    
                                     Illumina [1-2]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                  
                                      
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                     | 
                                
| Accession | MIMAT0019211 | 
| Description | Homo sapiens hsa-miR-3158-5p mature miRNA | 
| Sequence | 13 - CCUGCAGAGAGGAAGCCCUUC - 33 | 
| Evidence | not_experimental | 
                        
  |