WARNING: This summary was generated by AI. MIR3158-1 is a microRNA implicated in split-hand/foot malformation (SHFM), a congenital limb disorder [PMC5003447]. In SHFM cases, duplications often include MIR3158-1, alongside genes such as BTRC, POLL, DPCD, and FBXW4 [PMC5003447]. Specifically, MIR3158-1 is part of the shortest duplicated region identified in patients without microarray data and is consistently duplicated in the majority of SHFM cases [PMC5003447]. The duplication patterns involving MIR3158-1 vary; some patients have continuous duplications while others have two discontinuous duplications at the 10q24.31–q24.32 locus [PMC5003447'>PMC5003447]. In one instance, a patient with atypical SHFM features harbored a 241.59 kb duplication at 10q24.31-q24.32 that included MIR3158-1 [PMC5003447]. This suggests that duplications involving MIR3158-1 may contribute to a broader spectrum of phenotypes beyond classical SHFM presentations [PMC5003447].
--- u
auucaggccgguCCUGCAGAGAGGAAGCCCUUCu gcu a
|||||||||||||||||||||||||||||||||| |||
uaaguccggcCAGGACGUCUCUCCUUCGGGAAgg ugg c
uua a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0015032 |
| Description | Homo sapiens hsa-miR-3158-3p mature miRNA |
| Sequence | 50 - AAGGGCUUCCUCUCUGCAGGAC - 71 |
| Evidence |
experimental
Illumina [1-2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0019211 |
| Description | Homo sapiens hsa-miR-3158-5p mature miRNA |
| Sequence | 13 - CCUGCAGAGAGGAAGCCCUUC - 33 |
| Evidence | not_experimental |
|