miRBase entry: hsa-mir-3158-1

Stem-loop hsa-mir-3158-1


Accession
MI0014186
Symbol
HGNC: MIR3158-1
Description
Homo sapiens hsa-mir-3158-1 precursor miRNA mir-3158
Gene
family?
RF03941; mir-3158

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR3158-1 is a gene that is found in cases of Split-Hand/Foot Malformation (SHFM) and is duplicated in the majority of SHFM cases [PMC5003447]. In SHFM cases without microarray data, the shortest duplication contains MIR3158-1, along with other genes such as BTRC, POLL, DPCD, MIR3158-2, and a portion of FBXW4 [PMC5003447]. This duplication was found in Patient 35 and 40 [PMC5003447]. In the majority of SHFM cases with microarray data, the duplication also includes LBX1, BTRC, POLL, DPCD, MIR3158-2 and FBXW4 or a portion of FBXW4 [PMC5003447'>PMC5003447'>PMC5003447'>PMC5003447'>PMC5003447'>PMC5003447]. The duplicated segment in these cases extends from centromeric to telomeric direction [PMC5003447]. Patients 30 and 31 have a centromeric duplicated segment containing TLX1NB and TLX1 and a telomeric duplicated segment containing BTRC, POLL, DPCD, MIR3158-1,MIR3158-2,and a portion of FBXW4 (exon 9–7) [PMC5003447]. In some SHFM cases with two discontinuous duplications at 10q24.31–q24.32 (Patient 12–15), one duplication contains LBX1,BTRC,POLL,DPCD,MIR3158-1,MIR3158-2,and a portion of FBXW4 from centromeric to telomeric direction while the other contains LINC01514,LBX1,BTRC,POLL,DPCD,MIR3158-1,MIR3158-2,and a portion of FBXW4 from centromeric to telomeric direction [PMC5003447]. In Patient 18, a 241.59 kb duplication at 10q24.31-q24.32 containing a portion of BTRC, the entire POLL, DPCD, MIR3158-1, MIR3158-2, and a portion of FBXW4 was found [PMC5003447]. This patient exhibited certain phenotypic features associated with SHFM [PMC5003447]. In Patient 1, a 514 kb duplication at 10q24.31-10q24.32 containing LBX1,BTRC,POLL,DPCD,MIR3158-1,MIR3158-2,and FBXW4 was observed [PMC5003447].


Sequence

6644 reads, 99 reads per million, 73 experiments
auucaggccgguCCUGCAGAGAGGAAGCCCUUCugcuuacagguauuggAAGGGCUUCCUCUCUGCAGGACcggccugaau
(((((((((((((((((((((((((((((((((((((....)))...))))))))))))))))))))))))))))))))))

Structure
                                  ---   u 
auucaggccgguCCUGCAGAGAGGAAGCCCUUCu   gcu a
||||||||||||||||||||||||||||||||||   |||  
uaaguccggcCAGGACGUCUCUCCUUCGGGAAgg   ugg c
                                  uua   a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr10: 101601417-101601497 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-3158-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-3158-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-3158-3p

Accession MIMAT0015032
Description Homo sapiens hsa-miR-3158-3p mature miRNA
Sequence 50 - AAGGGCUUCCUCUCUGCAGGAC - 71
Evidence experimental
Illumina [1-2]
Database links
Predicted targets

Mature hsa-miR-3158-5p

Accession MIMAT0019211
Description Homo sapiens hsa-miR-3158-5p mature miRNA
Sequence 13 - CCUGCAGAGAGGAAGCCCUUC - 33
Evidence not_experimental

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 20224791
    Discovery of novel microRNAs in female reproductive tract using next generation sequencing
    Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH
    PLoS One (2010) 5:e9637

  3. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86