miRBase entry: hsa-mir-3180-1

Stem-loop hsa-mir-3180-1


Accession
MI0014214
Symbol
HGNC: MIR3180-1
Description
Homo sapiens hsa-mir-3180-1 precursor miRNA mir-3180
Gene
family?
RF02010; mir-3180

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR3180-3, a microRNA, has been identified as having a disruptive presence in an individual from Tibet, affecting its target genes CD44 and FAM115A [PMC3938728]. This microRNA is also implicated in Alzheimer's disease (AD), as it targets genes involved in neuroprotective roles and blood vessel remodeling [PMC7047416]. MIR3180-3 is differentially expressed alongside other lncRNAs and PCGs that are potential markers for AD, sharing co-expressed PCGs such as VTI1A and CUX1 that are associated with AD [PMC7047416]. It is highly expressed in cerebral tissue, indicating its significance in brain-related functions and diseases [PMC7047416]. Furthermore, MIR3180-3 has been found to be co-expressed with well-known AD-related genes within a network analysis [PMC7047416]. In the context of breast cancer, MIR3180-3 is identified in multiple breast cancer cell lines but absent in normal-like cell lines, suggesting its potential role as an oncogenic factor [PMC8261273]. However, it is not accurate to state that it regulates several target genes within the luminal-A subtype of breast cancer cells; the evidence only specifies that it targets the gene A4GALT in luminal-A breast cancer cells [PMC8261273], indicating its involvement in this particular disease and cellular process.

Literature search
7 open access papers mention hsa-mir-3180-1
(61 sentences)

Sequence

4408 reads, 123 reads per million, 62 experiments
cagugcgacgggcggagCUUCCAGACGCUCCGCCCCACGUCGcaugcgccccgggaaagcgUGGGGCGGAGCUUCCGGAGGCCccgcccugcug
....(((..((((((.((((((.((.((((((((((((((....(.((...)).)...)))))))))))))).)).)))))).)))))))))..

Structure
cagu   ac      a      A  C              CGca g  c 
    gcg  gggcgg gCUUCC GA GCUCCGCCCCACGU    u cg  
    |||  |||||| |||||| || ||||||||||||||    | || c
    cgu  cccgcc CGGAGG CU CGAGGCGGGGUgcg    g gc  
--gu   --      C      C  U              -aaa g  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr16: 14911220-14911313 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-3180-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-3180-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-3180-5p

Accession MIMAT0015057
Description Homo sapiens hsa-miR-3180-5p mature miRNA
Sequence 18 - CUUCCAGACGCUCCGCCCCACGUCG - 42
Evidence experimental
Illumina [1]
Database links
Predicted targets

Mature hsa-miR-3180-3p

Accession MIMAT0015058
Description Homo sapiens hsa-miR-3180-3p mature miRNA
Sequence 62 - UGGGGCGGAGCUUCCGGAGGCC - 83
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 20224791
    Discovery of novel microRNAs in female reproductive tract using next generation sequencing
    Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH
    PLoS One (2010) 5:e9637

  3. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86