gga-mir-219b is a type of microRNA that is downregulated in tumorous spleen and liver compared to non-tumorous samples [PMC5484716]. It has been found to inhibit the proliferation, migration, and invasion of MSB-1 cells by targeting the B-cell chronic lymphoma 11B (BCL11B) gene [PMC6862082]. The interaction between gga-mir-219b and BCL11B was confirmed through experiments that showed gga-mir-219b overexpression and BCL11B knockdown induced tumor cell apoptosis [PMC5484716]. The binding site for gga-mir-219b on BCL11B was identified as the 461–467 site in the seed region [PMC5484716]. The effect of gga-mir-219b on cell invasion was evaluated by examining the expression levels of MMP2 and MMP9, which are genes associated with cell invasion [PMC5484716'>PMC5484716'>PMC5484716]. It was found that gga-mir-219b overexpression and BCL11B knockdown inhibited migration of MSB1 cells [PMC5484716]. Luciferase reporter assays confirmed that BCL11B is a direct target gene of gga-mir-219b [PMC5484716]. Furthermore, gga-mir-219b has been shown to affect gene expression in apoptosis pathways, including the mitochondrial pathway and death receptor pathway [PMC5484716]. Overall, gga-mir-219b acts as a tumor suppressor by inhibiting tumor cell proliferation, apoptosis, migration, and invasion through its interaction with BCL11B [PMC5484716][PMC6862082][PMC9693605][PMC9721073[PMC6862082][PMC9693605][PMC9721073].
aca - a guu acg aaucucugcu gau guccagac caauucuug cgu g |||||||||| ||| |||||||| ||||||||| ||| c uuagagacga cuA CAGGUUUG GUUAAGAAC gcg u gga A C -AC acc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0016380 |
Description | Gallus gallus gga-miR-219b mature miRNA |
Sequence | 53 - CACAAGAAUUGCGUUUGGACAA - 74 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() |
Predicted targets |
![]() ![]() |
|