Stem-loop gga-mir-219b

Accession

MI0015382

Description

Gallus gallus gga-mir-219b precursor miRNA mir-219

Gene
family

RF00251; mir-219

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

gga-mir-219b is a type of microRNA that is downregulated in tumorous spleen and liver compared to non-tumorous samples [PMC5484716]. It has been found to inhibit the proliferation, migration, and invasion of MSB-1 cells by targeting the B-cell chronic lymphoma 11B (BCL11B) gene [PMC6862082]. The interaction between gga-mir-219b and BCL11B was confirmed through experiments that showed gga-mir-219b overexpression and BCL11B knockdown induced tumor cell apoptosis [PMC5484716]. The binding site for gga-mir-219b on BCL11B was identified as the 461–467 site in the seed region [PMC5484716]. The effect of gga-mir-219b on cell invasion was evaluated by examining the expression levels of MMP2 and MMP9, which are genes associated with cell invasion [PMC5484716'>PMC5484716'>PMC5484716]. It was found that gga-mir-219b overexpression and BCL11B knockdown inhibited migration of MSB1 cells [PMC5484716]. Luciferase reporter assays confirmed that BCL11B is a direct target gene of gga-mir-219b [PMC5484716]. Furthermore, gga-mir-219b has been shown to affect gene expression in apoptosis pathways, including the mitochondrial pathway and death receptor pathway [PMC5484716]. Overall, gga-mir-219b acts as a tumor suppressor by inhibiting tumor cell proliferation, apoptosis, migration, and invasion through its interaction with BCL11B [PMC5484716][PMC6862082][PMC9693605][PMC9721073[PMC6862082][PMC9693605][PMC9721073].

Literature search

6 open access papers mention gga-mir-219b
(15 sentences)

Sequence

109876 reads, 721 reads per million, 5 experiments

aaucucugcuacagauguccagacacaauucuugguucguacggcuccagcgCACAAGAAUUGCGUUUGGACAAucaggagcagagauu
((((((((((...(((((((((((.(((((((((...(((.........)))..))))))))).)))))))).)))...))))))))))

Structure

          aca   -        a         guu   acg 
aaucucugcu   gau guccagac caauucuug   cgu   g
||||||||||   ||| |||||||| |||||||||   |||   c
uuagagacga   cuA CAGGUUUG GUUAAGAAC   gcg   u
          gga   A        C         -AC   acc 

Annotation confidence Not enough data

Genome context

chr17: 5485245-5485333 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from gga-mir-219b

Mature gga-miR-219b

• Accession: MIMAT0016380
• Description: Gallus gallus gga-miR-219b mature miRNA
• Sequence: 53 - CACAAGAAUUGCGUUUGGACAA - 74
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 19891781
   Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach
   Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H
   BMC Genomics (2009) 10:512