miRBase entry: gga-mir-219b

Stem-loop gga-mir-219b


Accession
MI0015382
Description
Gallus gallus gga-mir-219b precursor miRNA mir-219
Gene
family?
RF00251; mir-219

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. gga-mir-219b, a microRNA, has been identified as a tumor suppressor in Marek's disease, with its expression downregulated in tumorous spleen and liver tissues [PMC5484716]. This microRNA targets B-cell chronic lymphoma 11B (BCL11B), and its overexpression or BCL11B knockdown has been shown to inhibit MSB-1 cell proliferation, migration, invasion, and to induce apoptosis [PMC5484716]. The interaction between gga-mir-219b and BCL11B affects the expression of genes in apoptosis pathways, including the mitochondrial and death receptor pathways [PMC5484716]. Moreover, gga-mir-219b overexpression leads to a decrease in the Marek's disease virus (MDV) oncogene Meq expression [PMC5484716'>PMC5484716]. The binding site for gga-mir-219b has been identified within the 461–467 site of BCL11B's seed region [PMC5484716]'>PMC5484716], with dual-luciferase reporter assays confirming BCL11B as a direct target of gga-mir-219b [PMC5484716]. The study's findings suggest that manipulating gga-mir-219b levels could be a potential strategy for controlling tumor cell behavior in Marek's disease [PMC5484716].

Literature search
6 open access papers mention gga-mir-219b
(15 sentences)

Sequence

59368 reads, 713 reads per million, 5 experiments
aaucucugcuacagauguccagacacaauucuugguucguacggcuccagcgCACAAGAAUUGCGUUUGGACAAucaggagcagagauu
((((((((((...(((((((((((.(((((((((...(((.........)))..))))))))).)))))))).)))...))))))))))

Structure
          aca   -        a         guu   acg 
aaucucugcu   gau guccagac caauucuug   cgu   g
||||||||||   ||| |||||||| |||||||||   |||   c
uuagagacga   cuA CAGGUUUG GUUAAGAAC   gcg   u
          gga   A        C         -AC   acc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr17: 5485245-5485333 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from gga-mir-219b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature gga-miR-219b

Accession MIMAT0016380
Description Gallus gallus gga-miR-219b mature miRNA
Sequence 53 - CACAAGAAUUGCGUUUGGACAA - 74
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 19891781
    Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach
    Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H
    BMC Genomics (2009) 10:512