WARNING: This summary was generated by AI. gga-mir-219b, a microRNA, has been identified as a tumor suppressor in Marek's disease, with its expression downregulated in tumorous spleen and liver tissues [PMC5484716]. This microRNA targets B-cell chronic lymphoma 11B (BCL11B), and its overexpression or BCL11B knockdown has been shown to inhibit MSB-1 cell proliferation, migration, invasion, and to induce apoptosis [PMC5484716]. The interaction between gga-mir-219b and BCL11B affects the expression of genes in apoptosis pathways, including the mitochondrial and death receptor pathways [PMC5484716]. Moreover, gga-mir-219b overexpression leads to a decrease in the Marek's disease virus (MDV) oncogene Meq expression [PMC5484716'>PMC5484716]. The binding site for gga-mir-219b has been identified within the 461–467 site of BCL11B's seed region [PMC5484716]'>PMC5484716], with dual-luciferase reporter assays confirming BCL11B as a direct target of gga-mir-219b [PMC5484716]. The study's findings suggest that manipulating gga-mir-219b levels could be a potential strategy for controlling tumor cell behavior in Marek's disease [PMC5484716].
aca - a guu acg
aaucucugcu gau guccagac caauucuug cgu g
|||||||||| ||| |||||||| ||||||||| ||| c
uuagagacga cuA CAGGUUUG GUUAAGAAC gcg u
gga A C -AC acc
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0016380 |
| Description | Gallus gallus gga-miR-219b mature miRNA |
| Sequence | 53 - CACAAGAAUUGCGUUUGGACAA - 74 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|