Stem-loop gma-MIR4416a

Accession

MI0016585

Description

Glycine max gma-MIR4416a precursor miRNA

Literature search

5 open access papers mention gma-MIR4416a
(11 sentences)

Sequence

cuuugaucugggugagagaaacgcguaucgauggauuggguucaguucuggucucacacgguuuguucuaacaauuuguacugacuguguuuugaucgauACGGGUCGCUCUCACCUAGGccagaguugc
(((((.((((((((((((..((.(((((((((((((((((......)))))))).((((((((.((.(.........).)).))))))))....))))))))).))..)))))))))))).)))))....

Structure

----     a            aa  g         ggauuggguucaguucuggucuc        u  u uaa 
    cuuug ucugggugagag  ac cguaucgau                       acacgguu gu c   c
    ||||| ||||||||||||  || |||||||||                       |||||||| || |   a
    gagac GGAUCCACUCUC  UG GCAuagcua                       ugugucag ca g   a
cguu     c            GC  G         -------------------guuu        u  u uuu 

Annotation confidence Not enough data

Genome context

chr19: 40891340-40891469 [-]

Mature gma-miR4416a

• Accession: MIMAT0018344
• Description: Glycine max gma-miR4416a mature miRNA
• Sequence: 101 - ACGGGUCGCUCUCACCUAGG - 120
• Evidence: experimental ; Illumina [1-2]

References

1. PubMed ID: 20122185
   Prediction of novel miRNAs and associated target genes in Glycine max
   Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
   BMC Bioinformatics (2010) 11:S14


2. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153