Stem-loop mmu-mir-3962

Accession

MI0016967

Symbol

MGI: Mir3962

Description

Mus musculus mmu-mir-3962 precursor miRNA

Literature search

2 open access papers mention mmu-mir-3962
(3 sentences)

Sequence

5267 reads, 13.0 reads per million, 109 experiments

uggguugagaaauguacucugccacguaggagcuAGGUAGUAGUUUGUACAUUUcuuacucccu
.(((.((((((((((((.((((.((.(((...))).)).))))...))))))))))))..))).

Structure

u   -u            --u    c  g   g 
 ggg  ugagaaauguac   cugc ac uag  
 |||  ||||||||||||   |||| || ||| a
 ccc  auucUUUACAUG   GAUG UG Auc  
u   uc            UUU    A  G   g 

Annotation confidence Not enough data

Genome context

1: 194504309-194504372 [+]

Mature mmu-miR-3962-3p

• Accession: MIMAT0019340
• Description: Mus musculus mmu-miR-3962-3p mature miRNA
• Sequence: 35 - AGGUAGUAGUUUGUACAUUU - 54
• Evidence: experimental ; Illumina [1-2]

References

1. PubMed ID: 20935160
   Next-generation sequencing identifies the natural killer cell microRNA transcriptome
   "Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER"
   "Genome Res (2010) 20:1590-1604


2. PubMed ID: 21403133
   Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage
   "Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S"
   "Blood (2011) 117:5340-5349