Stem-loop gma-MIR166h

Accession

MI0017834

Description

Glycine max gma-MIR166h precursor miRNA

Literature search

37 open access papers mention gma-MIR166h
(221 sentences)

Sequence

uggggaugaugGGAAUGUUGUUUGGCUCGAGGuaacugcauggucuuaauuuuguucaucuuuugaagcuuuaauuuauuuauggguuucaaucuuuuuugaucccuugaaacagaaaaagcuuuaaagguuggauuuugaggcuaucccuuuaugugaUCUCGGACCAGGCUUCAUUCCcgucaaccuu
..(((.(((((((((((..((((((.(((((((.((...((((((((((....(((((.(((((((((((((......((((.(((..((((......)))).))).))))......))))))))))))).))))).))))))))))........)).))))))).))))))..))))))))))).))).

Structure

ug   a           UU      C       a  -----ugc          uuuu     u             aauuua    u   uu    uc 
  ggg ugaugGGAAUG  GUUUGG UCGAGGu ac        auggucuuaa    guuca cuuuugaagcuuu      uuua ggg  ucaa  u
  ||| |||||||||||  |||||| ||||||| ||        ||||||||||    ||||| |||||||||||||      |||| |||  ||||   
  ucc acugcCCUUAC  CGGACC GGCUCUa ug        uaucggaguu    uaggu ggaaauuucgaaa      aagu ccc  aguu  u
-u   a           UU      A       g  uauuuccc          ---u     u             aagaca    u   -u    uu 

Annotation confidence Not enough data

Genome context

chr8: 14920990-14921179 [+]

Mature gma-miR166h-5p

• Accession: MIMAT0020983
• Description: Glycine max gma-miR166h-5p mature miRNA
• Sequence: 12 - GGAAUGUUGUUUGGCUCGAGG - 32
• Evidence: experimental ; Illumina [2]

Mature gma-miR166h-3p

• Accession: MIMAT0020984
• Description: Glycine max gma-miR166h-3p mature miRNA
• Sequence: 160 - UCUCGGACCAGGCUUCAUUCC - 180
• Evidence: experimental ; 454 [1], Illumina [2-3]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


2. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


3. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553