Stem-loop gma-MIR2118a

Accession

MI0017849

Description

Glycine max gma-MIR2118a precursor miRNA

Literature search

15 open access papers mention gma-MIR2118a
(44 sentences)

Sequence

aagggaaagggagaagagcuugaggaagugaugGGAGAUGGGAGGGUCGGUAAAGaauauaucugagacucgacucaaucucgaucucucucaguguuguguuguuuuguuuauccuuUUGCCGAUUCCACCCAUUCCUaugauuuccuucgguuccucucuuuccacuc
.((((((((((((..(((((.((((((((.(((((((.((((.((((((((((((((((((.((((((.((((.......))))....))))))...)))))).............))))))))).))).))))))))))).)))))))).))))))))))))))).)).

Structure

a  -          aa     u        g       A    A   -         -------------      --u      ---c    cu 
 ag ggaaagggag  gagcu gaggaagu augGGAG UGGG GGG UCGGUAAAG             aauaua   cugaga    ucga  c
 || ||||||||||  ||||| |||||||| ||||||| |||| ||| |||||||||             ||||||   ||||||    ||||  a
 uc ccuuucucuc  cuugg uuccuuua uaUCCUU ACCC CCU AGCCGUUuu             uugugu   gacucu    agcu  a
c  a          --     c        g       -    A   U         ccuauuuguuuug      ugu      cucu    cu 

Annotation confidence Not enough data

Genome context

chr20: 36443544-36443713 [+]

Mature gma-miR2118a-3p

• Accession: MIMAT0020999
• Description: Glycine max gma-miR2118a-3p mature miRNA
• Sequence: 119 - UUGCCGAUUCCACCCAUUCCU - 139
• Evidence: experimental ; 454 [1], Illumina [2-4]

Mature gma-miR2118a-5p

• Accession: MIMAT0022981
• Description: Glycine max gma-miR2118a-5p mature miRNA
• Sequence: 34 - GGAGAUGGGAGGGUCGGUAAAG - 55
• Evidence: experimental ; Illumina [3-4]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


2. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


3. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


4. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153