Stem-loop gma-MIR171i

Accession

MI0017907

Description

Glycine max gma-MIR171i precursor miRNA

Literature search

16 open access papers mention gma-MIR171i
(38 sentences)

Sequence

uuaaaggcaagcuugguggaaaugagagguagaggggaccgguucaacgggauauugguccgguucaAUAAGAAAGCAAUGCUCAAAauguuauuggguccuguuuuuucaUUGAGCCGUGCCAAUAUCACGaaacacuucucuucauacc
...(((.....))).............(((((((((((...(((...((.(((((((((.(((((((((.((((((((..((((((.......))))))..)))))))).))))))))).))))))))).)).)))...))))))).))))

Structure

uuaaaggcaagcuugguggaaaugaga    -       ccg   caa  g         c         A        AU      Aa 
                           ggua gagggga   guu   cg gauauuggu cgguucaAU AGAAAGCA  GCUCAA  u
                           |||| |||||||   |||   || ||||||||| ||||||||| ||||||||  ||||||  g
                           ccau cuucucu   caa   GC CUAUAACCG GCCGAGUUa uuuuuugu  uggguu  u
---------------------------    a       uca   --a  A         U         c        cc      au 

Annotation confidence Not enough data

Genome context

chr6: 49520830-49520980 [-]

Mature gma-miR171i-5p

• Accession: MIMAT0021056
• Description: Glycine max gma-miR171i-5p mature miRNA
• Sequence: 68 - AUAAGAAAGCAAUGCUCAAA - 87
• Evidence: experimental ; SOLiD [1], Illumina [2]

Mature gma-miR171i-3p

• Accession: MIMAT0021057
• Description: Glycine max gma-miR171i-3p mature miRNA
• Sequence: 112 - UUGAGCCGUGCCAAUAUCACG - 132
• Evidence: experimental ; Illumina [2]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


2. PubMed ID: 21751852
   Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome
   "Radwan O, Liu Y, Clough SJ"
   "Mol Plant Microbe Interact (2011) 24:958-972