Stem-loop ppe-MIR394a

Accession

MI0021616

Description

Prunus persica ppe-MIR394a precursor miRNA

Literature search

3 open access papers mention ppe-MIR394a
(4 sentences)

Sequence

ggguuuagcaaagcguuucuuacagaguuuaUUGGCAUUCUGUCCACCUCCucucuuuuucacucccuguguauuagaagauaguacguguggaggugggcauacugccaacugagcucuguuggcuucucuuuguaaaacccu
((((((.((((((.(...((.((((((((((((((((...((((((((((((((((....(((.....)))....)).)))..........)))))))))))...)))))).)))))))))).))...).)))))).)))))).

Structure

-      a      c uuu  u          -      UUC           ----------   -  uuuu   u 
 ggguuu gcaaag g   cu acagaguuua UUGGCA   UGUCCACCUCC          ucu cu    cac c
 |||||| |||||| |   || |||||||||| ||||||   |||||||||||          ||| ||    ||| c
 cccaaa uguuuc c   gg ugucucgagu aaccgu   acggguggagg          aga ga    gug c
u      a      u uuc  u          c      cau           ugugcaugau   a  uuau   u 

Annotation confidence Not enough data

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

chrG1: 33109945-33110088 [-]

Mature ppe-miR394a

• Accession: MIMAT0031167
• Description: Prunus persica ppe-miR394a mature miRNA
• Sequence: 32 - UUGGCAUUCUGUCCACCUCC - 51
• Evidence: experimental ; Illumina [2]

References

1. PubMed ID: 22863067
   High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot
   Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L
   BMC Genomics (2012) 13:371


2. PubMed ID: 22909020
   Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs
   Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z
   BMC Plant Biol (2012) 12:149