Stem-loop ppe-MIR6283

Accession

MI0021650

Description

Prunus persica ppe-MIR6283 precursor miRNA

Sequence

1605 reads, 107.0 reads per million, 20 experiments

uauagggagcugauuuucccacuucuCUUUUGUCCACUUACACUCucuuuuuuguuauaguaaaaaguauuagaaaaacaaaagggaguugaagugaCAAAAGGGGAGUGGGAAAAUCacuacccuau
.((((((((.((((((((((((((((((((((((.((((.((..((((((((((((....(((......)))....)))))))))))).)))))))))))))))))))))))))))))))).))))))

Structure

u      -  c                        C    A  CU            auag   aa 
 auaggg ag ugauuuucccacuucuCUUUUGUC ACUU CA  Cucuuuuuuguu    uaa  a
 |||||| || |||||||||||||||||||||||| |||| ||  ||||||||||||    |||   
 uauccc uc aCUAAAAGGGUGAGGGGAAAACag ugaa gu  gagggaaaacaa    auu  g
-      a  -                        -    -  -u            aaag   au 

Annotation confidence Low

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

chrG8: 20371635-20371762 [+]

Mature ppe-miR6283-5p

• Accession: MIMAT0058481
• Description: Prunus persica ppe-miR6283-5p mature miRNA
• Sequence: 27 - CUUUUGUCCACUUACACUC - 45
• Evidence: experimental ; unknown

Mature ppe-miR6283-3p

• Accession: MIMAT0027313
• Description: Prunus persica ppe-miR6283-3p mature miRNA
• Sequence: 98 - CAAAAGGGGAGUGGGAAAAUC - 118
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 22863067
   High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot
   Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L
   BMC Genomics (2012) 13:371