Stem-loop ppe-MIR6294

Accession

MI0021667

Description

Prunus persica ppe-MIR6294 precursor miRNA

Sequence

uggcacaacagauugugauuagccuacaccaagaugcaccaauacugcuagacuaaucacugaccauaaucaguaggaauuccggaccaaauugaauugaaggugcauaauugggugcaaugcuuuaauugacauugcucuagcaaucccacagagacagcauuggugcaucgUGGUGUAGGCUAAUCACAAUCuguuuuauac
......(((((((((((((((((((((((((.(((((((((((.(((((.........(((((......))))).((.((((.(((.(((..(.((((((((.(((((......)))))...)))))))).)..))).))).).))).))....)).))).))))))))))).)))))))))))))))))))))))))......

Structure

uggcac                         a           a   -  agacuaaucacugaccauaaucagua  a   - c   c   au g        --g     aa 
      aacagauugugauuagccuacacca gaugcaccaau cug cu                          gg auu c gga caa  u aauugaag   ugcau  u
      ||||||||||||||||||||||||| ||||||||||| ||| ||                          || ||| | ||| |||  | ||||||||   |||||   
      uuguCUAACACUAAUCGGAUGUGGU cuacgugguua gac ga                          cc uaa g ucu guu  a uuaauuuc   acgug  u
cauauu                         g           c   a  ----------------------gaca  c   c a   c   ac g        gua     gg 

Annotation confidence Not enough data

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

chrG5: 18318443-18318646 [+]

Mature ppe-miR6294

• Accession: MIMAT0027330
• Description: Prunus persica ppe-miR6294 mature miRNA
• Sequence: 174 - UGGUGUAGGCUAAUCACAAUC - 194
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 22863067
   High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot
   Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L
   BMC Genomics (2012) 13:371