Stem-loop prv-mir-LLT2

Accession

MI0022073

Description

Pseudorabies virus prv-mir-LLT2 precursor miRNA

Sequence

ccauucgcuuCUCAUCCCGUCAGACCUGCGccauggaguucgaggacgggcgcggggcaacgguggugagaggcgagccg
...(((((((((((((((((....((((((((.((...........))))))))))...)))).)))))))))))))...

Structure

cca             -    CAGA        a  gagu 
   uucgcuuCUCAUC CCGU    CCUGCGcc ug    u
   ||||||||||||| ||||    |||||||| ||    c
   gagcggagagugg ggca    gggcgcgg gc    g
gcc             u    -acg        -  agga 

Annotation confidence Not enough data

Genome context

NC_006151.1: 98376-98455 [+]

Clustered miRNAs

10 other miRNAs are < 10 kb from prv-mir-LLT2

Mature prv-miR-LLT2

• Accession: MIMAT0025305
• Description: Pseudorabies virus prv-miR-LLT2 mature miRNA
• Sequence: 11 - CUCAUCCCGUCAGACCUGCG - 30
• Evidence: experimental ; Illumina [1], Ion-Torrent [2]

References

1. PubMed ID: 22292087
   Pseudorabies virus infected porcine epithelial cell line generates a diverse set of host microRNAs and a special cluster of viral microRNAs
   Wu YQ, Chen DJ, He HB, Chen DS, Chen LL, Chen HC, Liu ZF
   PLoS One (2012) 7:e30988


2. PubMed ID: 24475202
   The role of viral and host microRNAs in the Aujeszky's disease virus during the infection process
   Timoneda O, Núñez-Hernández F, Balcells I, Muñoz M, Castelló A, Vera G, Pérez LJ, Egea R, Mir G, Córdoba S, Rosell R, Segalés J, Tomàs A, Sánchez A, Núñez JI
   PLoS One (2014) 9:e86965