Accession | MIMAT0000256 |
Description | hsa-miR-181a-5p mature miRNA |
Hairpins | |
Sequence | AACAUUCAACGCUGUCGGUGAGU |
Evidence |
experimental
cloned [2,4-6] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:1902461 negative regulation of mesenchymal stem cell proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22714950 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | has_input UniProtKB:P06401 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | has_input UniProtKB:P35625 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24848932 | has_input UniProtKB:P10145 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27767084 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18728182 | has_input UniProtKB:Q92831 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22042811 | has_input UniProtKB:P00797 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | has_input UniProtKB:O00571 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | has_input UniProtKB:P06401 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22492871 | has_input UniProtKB:P35625 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22714950 | has_input UniProtKB:P36897 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23993976 | has_input UniProtKB:Q9Y6W6 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24848932 | has_input UniProtKB:P10145 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535255 | has_input UniProtKB:P01375 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27767084 | has_input UniProtKB:P14867 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28323882 | has_input UniProtKB:Q8WXG6 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:18728182 | has_input UniProtKB:P04637 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:18728182 | has_input UniProtKB:P04637 |
involved_in | GO:0030335 positive regulation of cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23993976 | |
involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22714950 | has_input UniProtKB:P36897 |
involved_in | GO:0032690 negative regulation of interleukin-1 alpha production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23516523 | |
involved_in | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23516523 | |
involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23516523 | |
involved_in | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24848932 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|