miRBase entry: hsa-miR-628-3p

Mature hsa-miR-628-3p

Accession MIMAT0003297
Description hsa-miR-628-3p mature miRNA
Hairpins
Sequence UCUAGUAAGAGUGGCAGUCGA
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets


QuickGo Function

QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.


miR2Disease

A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.

Click here for more information and to obtain references for the studies.

Disease Differential expression Experiment Year Study
Comments or questions? Email mirbase@manchester.ac.uk