Accession | MIMAT0004762 |
Description | hsa-miR-486-3p mature miRNA |
Hairpins | |
Sequence | CGGGGCAGCUCAGUACAGGAU |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0008285 negative regulation of cell population proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24778011 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24778011 | has_input UniProtKB:P12643 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24778011 | has_input UniProtKB:P12643 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25857263 | has_input UniProtKB:O75444 |
involved_in | GO:0030854 positive regulation of granulocyte differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25857263 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24778011 | has_input UniProtKB:P12643 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25857263 | has_input UniProtKB:O75444 |
involved_in | GO:0045648 positive regulation of erythrocyte differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25857263 | |
involved_in | GO:0045650 negative regulation of macrophage differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25857263 | |
involved_in | GO:0045653 negative regulation of megakaryocyte differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25857263 | |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |