Stem-loop sequence hsa-let-7a-2

Accession

MI0000061 (change log)

Previous IDs

hsa-let-7a-2L

Symbol

HGNC:MIRLET7A2

Description

Homo sapiens let-7a-2 stem-loop

Gene family

MIPF0000002; let-7

Literature search

1268 open access papers mention hsa-let-7a-2
(7677 sentences)

Stem-loop

      uu   g   u             uagaa ua a 
5' agg  gag uag agguuguauaguu     u  c u
   |||  ||| ||| |||||||||||||     |  | c
3' ucc  uuc auc uccgacaugucaa     a  g a
      -u   g   c             --uag gg a 

Deep sequencing

71792486 reads, 1.43e+05 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr11: 122146522-122146593 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000387568 ; RP11-820L6.1-006; intron 2

  OTTHUMT00000387569 ; RP11-820L6.1-008; intron 2

  OTTHUMT00000387570 ; RP11-820L6.1-007; intron 2

  OTTHUMT00000387551 ; RP11-820L6.1-001; intron 3

  ENST00000529804 ; RP11-820L6.1-006; intron 2

  ENST00000529733 ; RP11-820L6.1-008; intron 2

  ENST00000528381 ; RP11-820L6.1-007; intron 2

  ENST00000527474 ; RP11-820L6.1-001; intron 3

Clustered miRNAs

< 10kb from hsa-let-7a-2

• hsa-mir-100: chr11: 122152229-122152308 [-]
• hsa-mir-10526: chr11: 122152103-122152156 [-]
• hsa-let-7a-2: chr11: 122146522-122146593 [-]

Database links

• EntrezGene:MIRLET7A2
• HGNC:MIRLET7A2
• RNAcentral:URS00003F0B88_9606
• Rfam:let-7
• miRBase Tracker:MI0000061

Mature sequence hsa-let-7a-5p

• Accession: MIMAT0000062
• Previous IDs: hsa-let-7a
• Sequence: 5 - ugagguaguagguuguauaguu - 26
• Deep sequencing: 215985765 reads, 159 experiments
• Evidence: experimental; cloned [1-3,5-8], Northern [1], Illumina [9]
• Database links:
  • RNAcentral:URS0000416056_9606
• Predicted targets:
  • TargetMiner:hsa-let-7a-5p
  • TargetScanVert:hsa-let-7a-5p
  • miRDB:hsa-let-7a-5p
  • microrna.org:hsa-let-7a-5p

Mature sequence hsa-let-7a-2-3p

• Accession: MIMAT0010195
• Previous IDs: hsa-let-7a-2*
• Sequence: 50 - cuguacagccuccuagcuuucc - 71
• Deep sequencing: 339 reads, 84 experiments
• Evidence: experimental; qRT-PCR [9]
• Database links:
  • RNAcentral:URS00000157F5_9606
• Predicted targets:
  • TargetMiner:hsa-let-7a-2-3p
  • TargetScanVert:hsa-let-7a-2-3p
  • miRDB:hsa-let-7a-2-3p
  • microrna.org:hsa-let-7a-2-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
5. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
8. PMID:17989717 "Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis" Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A Leukemia. 22:330-338(2008).
9. PMID:19015728 "MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells" Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L, Katzenellenbogen M, Ben-Shushan E, Reubinoff BE, Galun E PLoS One. 3:e3726(2008).
10. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).