miRBase entry: hsa-mir-24-1

Stem-loop hsa-mir-24-1


Accession
MI0000080
Symbol
HGNC: MIR24-1
Description
Homo sapiens hsa-mir-24-1 precursor miRNA
Gene family
MIPF0000041; mir-24

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR24-1 is a microRNA that is associated with various diseases, including familial breast cancer and cervical cancer [PMC4215120]. It is located downstream of the human SLITRK1 gene and shares a high nucleotide identity with the porcine SLITRK1 recognition sequence [PMC4215120]. MIR24-1 is conserved in different species and is clustered with miR-23 and miR-27 on human chromosomes 9 and 19 [PMC4215120]. Overexpression of MIR24-1 has been shown to increase H3K27ac levels at enhancers with complementary sequences to miR-24-1 [PMC8954937]. It has been suggested that MIR24-1 may be downregulated in response to long-term potentiation (LTP), allowing the expression of a subset of linked genes [PMC3393663]. However, there seems to be no crossover between the predicted target genes of MIR34a and MIR24-1 in LTP datasets [PMC3393663]. Target prediction algorithms have identified several potential mRNA targets for MIR24-1, including FOXO1, NUMBL, and others [PMC3393663]. In addition to its role in LTP, MIR24-1 has been implicated in other biological processes such as cell proliferation and angiogenesis regulation [PMC3393663] [PMC9687337]. Knockout mice lacking both MIR24-1 and Mir24-2 have been generated using CRISPR technology [PMC8684555]. Furthermore, upregulation of MIR24-1 has been observed in response to exposure to amyloid-beta (Aβ) in nAChR-expressing cells [PMC7105468].

Literature search
347 open access papers mention hsa-mir-24-1
(2066 sentences)

Sequence

804753 reads, 2988 reads per million, 159 experiments
cuccggUGCCUACUGAGCUGAUAUCAGUucucauuuuacacacUGGCUCAGUUCAGCAGGAACAGgag
((((.((.(((.(((((((((..(((((.............))))).))))))))).))).)).))))

Structure
    g  G   A         UA     ucuca 
cucc gU CCU CUGAGCUGA  UCAGU     u
|||| || ||| |||||||||  |||||     u
gagG CA GGA GACUUGACU  GGUca     u
    A  A   C         -C     cacau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr9: 95086021-95086088 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from hsa-mir-24-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-24-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-24-1 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-24-1 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-24-1-5p

Accession MIMAT0000079
Description Homo sapiens hsa-miR-24-1-5p mature miRNA
Sequence 7 - UGCCUACUGAGCUGAUAUCAGU - 28
Evidence experimental
cloned [7]
Database links
Predicted targets

Mature hsa-miR-24-3p

Accession MIMAT0000080
Description Homo sapiens hsa-miR-24-3p mature miRNA
Sequence 44 - UGGCUCAGUUCAGCAGGAACAG - 65
Evidence experimental
cloned [1,4-7], Northern [1], Illumina [8]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  7. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  8. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  9. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179