Stem-loop sequence hsa-mir-93

Accession

MI0000095 (change log)

Previous IDs

hsa-mir-93-7.1;hsa-mir-93-1

Symbol

HGNC:MIR93

Description

Homo sapiens miR-93 stem-loop

Gene family

MIPF0000001; mir-17

Literature search

297 open access papers mention hsa-mir-93
(1877 sentences)

Stem-loop

             -ca       -     u    g   ug  au 
5' cugggggcuc   aagugcu guucg gcag uag  ug  u
   ||||||||||   ||||||| ||||| |||| |||  ||   
3' ggcccccgag   uucacga cgagu cguc auc  ac  a
             ccc       u     -    -   ca  cc 

Deep sequencing

775423 reads, 2e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-93-7.1 and mir-93-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-93 locus on chromosome 7. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr7: 100093768-100093847 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-93

• hsa-mir-106b: chr7: 100093993-100094074 [-]
• hsa-mir-93: chr7: 100093768-100093847 [-]
• hsa-mir-25: chr7: 100093560-100093643 [-]

Database links

• EntrezGene:MIR93
• HGNC:MIR93
• RNAcentral:URS00000DDD35_9606
• miRBase Tracker:MI0000095

Mature sequence hsa-miR-93-5p

• Accession: MIMAT0000093
• Previous IDs: hsa-miR-93
• Sequence: 11 - caaagugcuguucgugcagguag - 33
• Deep sequencing: 764621 reads, 158 experiments
• Evidence: experimental; cloned [1,3-6], Northern [4]
• Database links:
  • RNAcentral:URS0000149452_9606
• Predicted targets:
  • TargetMiner:hsa-miR-93-5p
  • TargetScanVert:hsa-miR-93-5p
  • miRDB:hsa-miR-93-5p
  • microrna.org:hsa-miR-93-5p

Mature sequence hsa-miR-93-3p

• Accession: MIMAT0004509
• Previous IDs: hsa-miR-93*
• Sequence: 50 - acugcugagcuagcacuucccg - 71
• Deep sequencing: 10791 reads, 156 experiments
• Evidence: experimental; cloned [5]
• Database links:
  • RNAcentral:URS00000FB1B1_9606
• Predicted targets:
  • TargetMiner:hsa-miR-93-3p
  • TargetScanVert:hsa-miR-93-3p
  • miRDB:hsa-miR-93-3p
  • microrna.org:hsa-miR-93-3p

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).