![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-93 |
||||||||
Accession | MI0000095 (change log) | |||||||
Previous IDs | hsa-mir-93-7.1;hsa-mir-93-1 | |||||||
Symbol | HGNC:MIR93 | |||||||
Description | Homo sapiens miR-93 stem-loop | |||||||
Gene family | MIPF0000001; mir-17 | |||||||
Literature search |
![]()
297 open access papers mention hsa-mir-93 | |||||||
Stem-loop |
-ca - u g ug au 5' cugggggcuc aagugcu guucg gcag uag ug u |||||||||| ||||||| ||||| |||| ||| || 3' ggcccccgag uucacga cgagu cguc auc ac a ccc u - - ca cc |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-93-7.1 and mir-93-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-93 locus on chromosome 7. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-93-5p |
|
Accession | MIMAT0000093 |
Previous IDs | hsa-miR-93 |
Sequence |
11 - caaagugcuguucgugcagguag - 33 |
Deep sequencing | 764621 reads, 158 experiments |
Evidence | experimental; cloned [1,3-6], Northern [4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-93-3p |
|
Accession | MIMAT0004509 |
Previous IDs | hsa-miR-93* |
Sequence |
50 - acugcugagcuagcacuucccg - 71 |
Deep sequencing | 10791 reads, 156 experiments |
Evidence | experimental; cloned [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
3 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
4 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|