Stem-loop sequence hsa-mir-34a

Accession

MI0000268 (change log)

Previous IDs

hsa-mir-34

Symbol

HGNC:MIR34A

Description

Homo sapiens miR-34a stem-loop

Gene family

MIPF0000039; mir-34

Literature search

927 open access papers mention hsa-mir-34a
(8921 sentences)

Stem-loop

   -    -a  --    -  ug     uu        -   a          -guga  a 
5'  ggcc  gc  ugug ag  uuucu  ggcagugu cuu gcugguuguu     gc a
    ||||  ||  |||| ||  |||||  |||||||| ||| ||||||||||     ||  
3'  ccgg  ug  gcac uc  gaaga  ccgucaua gaa cgacuaacga     ug u
   c    gg  uu    g  gu     uc        u   -          aggaa  a 

Deep sequencing

160671 reads, 269 reads per million, 156 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Dostie et al. independently cloned this sequence in human but misnamed the sequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis) [2]. The sequence maps to human chromosome 1. Human miR-34a was previously named miR-34 here and in [1], but is renamed to clarify homology with the alternatively named mouse sequence (MI0000584). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 9151668-9151777 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR34A
• HGNC:MIR34A
• RNAcentral:URS000033F823_9606
• miRBase Tracker:MI0000268

Mature sequence hsa-miR-34a-5p

• Accession: MIMAT0000255
• Previous IDs: hsa-miR-34a
• Sequence: 22 - uggcagugucuuagcugguugu - 43
• Deep sequencing: 155952 reads, 154 experiments
• Evidence: experimental; cloned [2-4]
• Database links:
  • RNAcentral:URS000030BD69_9606
• Predicted targets:
  • TargetMiner:hsa-miR-34a-5p
  • TargetScanVert:hsa-miR-34a-5p
  • miRDB:hsa-miR-34a-5p
  • microrna.org:hsa-miR-34a-5p

Mature sequence hsa-miR-34a-3p

• Accession: MIMAT0004557
• Previous IDs: hsa-miR-34a*
• Sequence: 64 - caaucagcaaguauacugcccu - 85
• Deep sequencing: 4130 reads, 121 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS00000EED18_9606
• Predicted targets:
  • TargetMiner:hsa-miR-34a-3p
  • TargetScanVert:hsa-miR-34a-3p
  • miRDB:hsa-miR-34a-3p
  • microrna.org:hsa-miR-34a-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).