miRBase entry: mmu-mir-181c

Stem-loop mmu-mir-181c


Accession
MI0000724
Symbol
MGI: Mir181c
Description
Mus musculus mmu-mir-181c precursor miRNA
Gene family
MIPF0000007; mir-181

Literature search
134 open access papers mention mmu-mir-181c
(681 sentences)

Sequence

354082 reads, 830 reads per million, 106 experiments
gccaaggguuugggggAACAUUCAACCUGUCGGUGAGUuugggcagcucagacaaACCAUCGACCGUUGAGUGGACCccgaggccugga
.(((.((.(((((((...((((((((..(((((((.(((((...........)))))))))))).))))))))..))))))).))))).

Structure
g   a  g       gAA        CU       A     ggca 
 cca gg uuugggg   CAUUCAAC  GUCGGUG GUuug    g
 ||| || |||||||   ||||||||  ||||||| |||||    c
 ggu cc gagccCC   GUGAGUUG  CAGCUAC CAaac    u
a   -  g       -AG        -C       -     agac 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse miR-181c was predicted by computational methods using conservation with human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish and independently in mouse [2,3].

Genome context
chr8: 84178873-84178961 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-181c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-181c-5p

Accession MIMAT0000674
Description Mus musculus mmu-miR-181c-5p mature miRNA
Sequence 17 - AACAUUCAACCUGUCGGUGAGU - 38
Evidence experimental
cloned [2-3], Illumina [4,6]
Database links
Predicted targets

Mature mmu-miR-181c-3p

Accession MIMAT0017068
Description Mus musculus mmu-miR-181c-3p mature miRNA
Sequence 56 - ACCAUCGACCGUUGAGUGGACC - 77
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275