miRBase entry: mmu-mir-181b-2

Stem-loop mmu-mir-181b-2


Accession
MI0000823
Symbol
MGI: Mir181b-2
Description
Mus musculus mmu-mir-181b-2 precursor miRNA
Gene family
MIPF0000007; mir-181

Literature search
163 open access papers mention mmu-mir-181b-2
(1258 sentences)

Sequence

901790 reads, 2033 reads per million, 107 experiments
uugauggcugcacucAACAUUCAUUGCUGUCGGUGGGUUugaaugucaaccaaCUCACUGAUCAAUGAAUGCAAAcugcgggccaaaaa
....((((((((.....(((((((((..((((((((((((((...)))...)))))))))))))))))))).....))).)))))....

Structure
uuga     -   cucAA         CU           ---   a 
    uggcu gca     CAUUCAUUG  GUCGGUGGGUU   uga  
    ||||| |||     |||||||||  |||||||||||   ||| u
    accgg cgu     GUAAGUAAC  UAGUCACUCaa   acu  
aaaa     g   cAAAC         --           cca   g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr2: 38853830-38853918 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-181b-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-181b-5p

Accession MIMAT0000673
Description Mus musculus mmu-miR-181b-5p mature miRNA
Sequence 16 - AACAUUCAUUGCUGUCGGUGGGUU - 39
Evidence experimental
cloned [2-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-181b-2-3p

Accession MIMAT0017084
Description Mus musculus mmu-miR-181b-2-3p mature miRNA
Sequence 54 - CUCACUGAUCAAUGAAUGCAAA - 75
Evidence experimental
Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009