![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR408 |
|||||
Accession | MI0002352 (change log) | ||||
Description | Populus trichocarpa miR408 stem-loop | ||||
Gene family | MIPF0000102; MIR408 | ||||
Literature search |
![]()
5 open access papers mention ptc-MIR408 | ||||
Stem-loop |
a a g u aaga c a a cu aa 5' gag ca a g cggggaa aggcag gcaugg uggagcua aacag g ||| || | | ||||||| |||||| |||||| |||||||| ||||| 3' cuc gu u c gucccuu uccguc cguacc aucucggu uuguu u - g g u ---g c a c -u ca |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ptc-miR408-5p |
|
Accession | MIMAT0022913 |
Sequence |
16 - cggggaacaggcagagcaugg - 36 |
Evidence | experimental; miRNAseq [5] |
Mature sequence ptc-miR408-3p |
|
Accession | MIMAT0002058 |
Previous IDs | ptc-miR408 |
Sequence |
76 - augcacugccucuucccuggc - 96 |
Evidence | experimental; cloned [1], miRNAseq [5] |
References |
|
1 |
PMID:15994906
"Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis"
Plant Cell. 17:2186-2203(2005).
|
2 |
PMID:15916721
"Identification and characterization of new plant microRNAs using EST analysis"
Cell Res. 15:336-360(2005).
|
3 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
4 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|
5 |
PMID:22442676
"Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets"
PLoS One. 7:e33034(2012).
|