Stem-loop mmu-mir-543

Accession

MI0003519

Symbol

MGI: Mir543

Description

Mus musculus mmu-mir-543 precursor miRNA

Gene family

MIPF0000110; mir-329

Literature search

15 open access papers mention mmu-mir-543
(167 sentences)

Sequence

22353 reads, 445 reads per million, 78 experiments

ugcuuaaugagAAGUUGCCCGCGUGUUUUUCGcuuuauaugugacgAAACAUUCGCGGUGCACUUCUUuuucagca
((((.((.(((((((.(((((((((((((((((.......)))).))))))..))))).))))))))).)).))))

Structure

    u  u       U  -     --      -    uu 
ugcu aa gagAAGU GC CCGCG  UGUUUU UCGc  u
|||| || ||||||| || |||||  |||||| ||||  a
acga uu UUCUUCA CG GGCGC  ACAAAg agug  u
    c  u       -  U     UU      c    ua 

Annotation confidence Not enough data

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chr12: 109717258-109717333 [+]

Clustered miRNAs

21 other miRNAs are < 10 kb from mmu-mir-543

Mature mmu-miR-543-5p

• Accession: MIMAT0017207
• Description: Mus musculus mmu-miR-543-5p mature miRNA
• Sequence: 12 - AAGUUGCCCGCGUGUUUUUCG - 32
• Evidence: experimental ; 454 [6], Illumina [7]

Mature mmu-miR-543-3p

• Accession: MIMAT0003168
• Description: Mus musculus mmu-miR-543-3p mature miRNA
• Sequence: 47 - AAACAUUCGCGGUGCACUUCUU - 68
• Evidence: experimental ; cloned [1,4], MPSS [2], miRAP-cloned [3], Illumina [5,7]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275


5. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771


6. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267


7. PubMed ID: 16973894
   Mouse microRNA profiles determined with a new and sensitive cloning method
   "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
   "Nucleic Acids Res (2006) 34:e115