![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-199a-1 |
||||||||
Accession | MI0004758 (change log) | |||||||
Previous IDs | bta-mir-199a | |||||||
Description | Bos taurus miR-199a-1 stem-loop | |||||||
Gene family | MIPF0000040; mir-199 | |||||||
Literature search |
![]()
24 open access papers mention bta-mir-199a-1 | |||||||
Stem-loop |
uggaagcuucuggagau - c gcc u c --uca ac 5' ccu gcuc guc ccagugu cagacuac ugu gg a ||| |||| ||| ||||||| |||||||| ||| || 3' gga cggg cag gguuaca gucugaug aca cc a ----------------g a u auu c - uguug gu |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence bta-miR-199a-5p |
|
Accession | MIMAT0003544 |
Previous IDs | bta-miR-199a |
Sequence |
31 - cccaguguucagacuaccuguu - 52 |
Deep sequencing | 99439 reads, 64 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
Mature sequence bta-miR-199a-3p |
|
Accession | MIMAT0003746 |
Previous IDs | bta-miR-199a* |
Sequence |
70 - acaguagucugcacauugguua - 91 |
Deep sequencing | 733416 reads, 68 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
3 |
PMID:19758457
"Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
BMC Mol Biol. 10:90(2009).
|