Stem-loop sequence bta-mir-199a-1

AccessionMI0004758 (change log)
Previous IDsbta-mir-199a
DescriptionBos taurus miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Literature search

24 open access papers mention bta-mir-199a-1
(77 sentences)

Stem-loop 
   uggaagcuucuggagau   -    c   gcc       u        c   --uca  ac 
5'                  ccu gcuc guc   ccagugu cagacuac ugu     gg  a
                    ||| |||| |||   ||||||| |||||||| |||     ||   
3'                  gga cggg cag   gguuaca gucugaug aca     cc  a
   ----------------g   a    u   auu       c        -   uguug  gu
Get sequence
Deep sequencing
416652 reads, 3.31e+03 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 40646156-40646259 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-199a-1
bta-mir-199a-1chr16: 40646156-40646259 [-]
bta-mir-3120chr16: 40640371-40640451 [+]
bta-mir-214chr16: 40640361-40640470 [-]
Database links

Mature sequence bta-miR-199a-5p

Accession MIMAT0003544
Previous IDsbta-miR-199a
Sequence

31 -  

cccaguguucagacuaccuguu

 - 52

Get sequence
Deep sequencing99439 reads, 64 experiments
Evidence experimental; cloned [1-2]
Predicted targets

Mature sequence bta-miR-199a-3p

Accession MIMAT0003746
Previous IDsbta-miR-199a*
Sequence

70 -  

acaguagucugcacauugguua

 - 91

Get sequence
Deep sequencing733416 reads, 68 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).