Stem-loop sequence bta-mir-29b-1

AccessionMI0010464 (change log)
DescriptionBos taurus miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Literature search

39 open access papers mention bta-mir-29b-1
(257 sentences)

Stem-loop 
   -         -          u      gu      uuaaa 
5'  cuucaggaa gcugguuuca auggug  uuagau     u
    ||||||||| |||||||||| ||||||  ||||||     a
3'  gggguucuu ugacuaaagu uaccac  gaucug     g
   g         g          u      --      uuagu
Get sequence
Deep sequencing
142310 reads, 674 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 95727243-95727323 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-29b-1
bta-mir-29b-1chr4: 95727243-95727323 [-]
bta-mir-29achr4: 95726868-95726931 [-]
Database links

Mature sequence bta-miR-29b

Accession MIMAT0003828
Sequence

51 -  

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Deep sequencing284410 reads, 76 experiments
Evidence experimental; cloned [1,4], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
4
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).