miRBase entry: bta-mir-29b-1

Stem-loop bta-mir-29b-1


Accession
MI0010464
Description
Bos taurus bta-mir-29b-1 precursor miRNA
Gene family
MIPF0000009; mir-29

Literature search
39 open access papers mention bta-mir-29b-1
(262 sentences)

Sequence

3136 reads, 359 reads per million, 74 experiments
cuucaggaagcugguuucauauggugguuuagauuuaaauagugauugucUAGCACCAUUUGAAAUCAGUGUUcuuggggg
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))).

Structure
-         -          u      gu      uuaaa 
 cuucaggaa gcugguuuca auggug  uuagau     u
 ||||||||| |||||||||| ||||||  ||||||     a
 gggguucUU UGACUAAAGU UACCAC  GAUcug     g
g         G          U      --      uuagu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 95727243-95727323 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-mir-29b-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bta-miR-29b

Accession MIMAT0003828
Description Bos taurus bta-miR-29b mature miRNA
Sequence 51 - UAGCACCAUUUGAAAUCAGUGUU - 73
Evidence experimental
cloned [1,4], Array [2], qRT-PCR [2]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43

  2. PubMed ID: 19170227
    Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach
    "Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M"
    "Mol Reprod Dev (2009) 76:665-677

  3. PubMed ID: 19758457
    Characterization of bovine miRNAs by sequencing and bioinformatics analysis
    Jin W, Grant JR, Stothard P, Moore SS, Guan LL
    BMC Mol Biol (2009) 10:90

  4. PubMed ID: 18945293
    Annotation of 390 bovine miRNA genes by sequence similarity with other species
    "Strozzi F, Mazza R, Malinverni R, Williams JL"
    "Anim Genet (2009) 40:125