Accession
MI0010464
Description
Bos taurus
bta-mir-29b-1 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
bta-mir-29b is a microRNA (miRNA) that plays a role in lipid metabolism and has been implicated in various biological processes in cattle. It was found to be down-regulated in mammary gland and primary mammary epithelial cells of cows with low lipid synthesis, suggesting it does not regulate lipid synthesis under these conditions [PMC4783934]. Additionally, bta-mir-29b is differentially expressed in the liver of cattle with different residual feed intakes, indicating its involvement in glucose homeostasis and lipid metabolism [PMC9039951]. It has also been identified as differentially expressed between bulls with varying fertility levels [PMC9581129]. In the context of viral infections, bta-mir-29b expression was upregulated following BVDV infection and was shown to suppress viral replication and apoptosis by regulating caspase-7 and NAIF1 levels [PMC5885596]. Moreover, its upregulation led to the downregulation of autophagy-associated proteins ATG14 and ATG9A during BVDV infection [PMC5885596]. In commercial milk extracellular vesicles (EVs), bta-mir-29b does not exhibit a specific enrichment pattern, suggesting the presence of multiple EV subtypes [PMC5994974]. Lastly, it has been shown to promote triglyceride production while suppressing apoptosis [PMC5765104], indicating its multifaceted role in bovine biological processes.
Literature search
39 open access papers mention bta-mir-29b-1
(262 sentences)
(262 sentences)
Sequence
3136
reads,
359
reads per million, 74 experiments
cuucaggaagcugguuucauauggugguuuagauuuaaauagugauugucUAGCACCAUUUGAAAUCAGUGUUcuuggggg
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))).
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))).
Structure
- - u gu uuaaa cuucaggaa gcugguuuca auggug uuagau u ||||||||| |||||||||| |||||| |||||| a gggguucUU UGACUAAAGU UACCAC GAUcug g g G U -- uuagu
Annotation confidence
Not enough data
Do you think this miRNA is real?
Genome context
chr4: 95727243-95727323 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-mir-29b-1
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Database links
Mature bta-miR-29b
| Accession | MIMAT0003828 |
| Description | Bos taurus bta-miR-29b mature miRNA |
| Sequence | 51 - UAGCACCAUUUGAAAUCAGUGUU - 73 |
| Evidence |
experimental
cloned [1,4], Array [2], qRT-PCR [2] |
References
|
