Stem-loop sequence dps-mir-2520

AccessionMI0011653 (change log)
DescriptionDrosophila pseudoobscura miR-2520 stem-loop
Stem-loop
   -  gagu    uucaagaacg   c    u           -c  -      c     aau 
5'  gg    ugau          gau guag acugaucgaga  gc uugcua uggag   u
    ||    ||||          ||| |||| |||||||||||  || |||||| |||||    
3'  cc    gcua          cua cguc ugauuagcuuu  cg aacgau accuu   c
   a  auac    -cgaaaaaaa   a    u           cc  c      a     cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8362599-8362718 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2520
dps-mir-2541XL_group1e: 8367679-8367786 [-]
dps-mir-2540XL_group1e: 8367333-8367441 [-]
dps-mir-2523XL_group1e: 8366995-8367108 [-]
dps-mir-2539XL_group1e: 8366678-8366788 [-]
dps-mir-2522aXL_group1e: 8365900-8366011 [-]
dps-mir-2522bXL_group1e: 8363413-8363514 [-]
dps-mir-2538XL_group1e: 8363244-8363359 [-]
dps-mir-2521XL_group1e: 8362756-8362842 [-]
dps-mir-2520XL_group1e: 8362599-8362718 [-]
dps-mir-2537XL_group1e: 8362508-8362587 [-]
dps-mir-2536XL_group1e: 8362342-8362452 [-]
Database links

Mature sequence dps-miR-2520

Accession MIMAT0012308
Sequence

68 - 

aauagcaacgcccuuucgauuagu

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).