Stem-loop sequence aae-mir-988

Accession

MI0013487 (change log)

Description

Aedes aegypti miR-988 stem-loop

Gene family

MIPF0000724; mir-988

Literature search

2 open access papers mention aae-mir-988
(4 sentences)

Stem-loop

               u c    ug    --u  -   -     
5' gcugcgggugug g uuug  acaa   ga gau ucgg 
   |||||||||||| | ||||  ||||   || ||| ||| u
3' uggcguucgcac c aaac  uguu   cu cua agcu 
               u c    gu    ccc  a   u     

Deep sequencing

961 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.442: 623050-623124 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0013487

Mature sequence aae-miR-988-5p

• Accession: MIMAT0014280
• Previous IDs: aae-miR-988*
• Sequence: 10 - gugugcuuugugacaaugaga - 30
• Deep sequencing: 101 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-988-3p

• Accession: MIMAT0014281
• Previous IDs: aae-miR-988
• Sequence: 47 - ccccuuguugcaaaccucacgc - 68
• Deep sequencing: 860 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).