Stem-loop sequence aae-mir-988

AccessionMI0013487 (change log)
DescriptionAedes aegypti miR-988 stem-loop
Gene family MIPF0000724; mir-988
Literature search

2 open access papers mention aae-mir-988
(4 sentences)

Stem-loop
               u c    ug    --u  -   -     
5' gcugcgggugug g uuug  acaa   ga gau ucgg 
   |||||||||||| | ||||  ||||   || ||| ||| u
3' uggcguucgcac c aaac  uguu   cu cua agcu 
               u c    gu    ccc  a   u     
Get sequence
Deep sequencing
961 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.442: 623050-623124 [-]
intergenic
Database links

Mature sequence aae-miR-988-5p

Accession MIMAT0014280
Previous IDsaae-miR-988*
Sequence

10 - 

gugugcuuugugacaaugaga

 - 30

Get sequence
Deep sequencing101 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-988-3p

Accession MIMAT0014281
Previous IDsaae-miR-988
Sequence

47 - 

ccccuuguugcaaaccucacgc

 - 68

Get sequence
Deep sequencing860 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).