Stem-loop sequence aae-mir-1000-1

AccessionMI0013502 (change log)
DescriptionAedes aegypti miR-1000-1 stem-loop
Gene family MIPF0000701; mir-1000
Literature search

3 open access papers mention aae-mir-1000-1
(15 sentences)

Stem-loop
   -c   uuuu       ac    uauau       uc         cuguu 
5'   gau    gcuagaa  cgau     uguccug  acagcagua     a
     |||    |||||||  ||||     |||||||  |||||||||      
3'   cug    cgaucuu  guua     acagggc  uguugucau     c
   ca   ---c       -a    cauuu       uu         uuaaa 
Get sequence
Deep sequencing
5763 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.187: 325456-325552 [+]
intergenic
Database links

Mature sequence aae-miR-1000

Accession MIMAT0014297
Sequence

23 - 

auauuguccugucacagcagu

 - 43

Get sequence
Deep sequencing11010 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).