Stem-loop sequence aly-MIR319a

AccessionMI0014518 (change log)
DescriptionArabidopsis lyrata miR319a stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
       guu  a        uau u     --          g      u   c   uc  g u           a -  u   ac        c  aa  c      gccaaaa 
5' ggau   gu ggaauaua   g agaga  gagcuuccuu agucca uca agg  gu a augauccaauu g cu ccg  ucauucau ca  ua cgaguc       u
   ||||   || ||||||||   | |||||  |||||||||| |||||| ||| |||  || | ||||||||||| | || |||  |||||||| ||  || ||||||        
3' ucug   ua ccuuaugu   c ucucu  cucgagggaa ucaggu agu ucu  ua u uacuagguuaa c ga ggc  aguaagua gu  au gcucag       u
       --u  a        cuu -     cc          g      u   u   cu  g -           a a  u   gu        a  aa  u      aucaagc 
Get sequence
Deep sequencing
7 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 7941288-7941508 [-]
intergenic
Database links

Mature sequence aly-miR319a-5p

Accession MIMAT0017429
Previous IDsaly-miR319a*
Sequence

28 - 

agagcuuccuugaguccauuc

 - 48

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR319a-3p

Accession MIMAT0017430
Previous IDsaly-miR319a
Sequence

177 - 

uuggacugaagggagcucccu

 - 197

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2