Stem-loop sequence aly-MIR167c

AccessionMI0014541 (change log)
DescriptionArabidopsis lyrata miR167c stem-loop
Gene family MIPF0000125; MIR167_2
Stem-loop
   cag      -uu                  u    uc       -     ----       -   --u    -uuaa     a 
5'    uagcag   aagcugccagcaugaucu gucu  cucucuu aaguu    ucauaua uaa   caag     uauaa g
      ||||||   |||||||||||||||||| ||||  ||||||| |||||    ||||||| |||   ||||     ||||| a
3'    aucguc   uuugauggucguacugga caga  gagagag uucga    aguauau auu   guuc     auguu u
   gua      cac                  u    ga       a     uacu       u   cuu    uuaac     u 
Get sequence
Deep sequencing
3133 reads, 1.09e+05 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 1657189-1657347 [-]
intergenic
Database links

Mature sequence aly-miR167c-5p

Accession MIMAT0017477
Previous IDsaly-miR167c
Sequence

11 - 

uaagcugccagcaugaucuug

 - 31

Get sequence
Deep sequencing3133 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR167c-3p

Accession MIMAT0017478
Previous IDsaly-miR167c*
Sequence

130 - 

aggucaugcugguaguuucac

 - 150

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2