Stem-loop sequence aly-MIR169h

AccessionMI0014552 (change log)
DescriptionArabidopsis lyrata miR169h stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
           cauau      aaaug    c    --    ug    c    g   -          u    u     -  uu     aaua    a  a       c    u 
5' uagaaaau     aagaga     guga auga  agaa  agaa uugu ugg uagccaagga gacu gccug cg  uuaac    caau uc aagacua ucga c
   ||||||||     ||||||     |||| ||||  ||||  |||| |||| ||| |||||||||| |||| ||||| ||  |||||    |||| || ||||||| ||||  
3' guuuuuug     uucucu     cacu uacu  ucuu  ucuu aaca acu aucgguuccu cuga cggac gc  gauug    guug ag uucugau agcu g
           ---cu      --cua    u    cc    gu    -    a   u          -    -     u  -u     ----    -  a       -    a 
Get sequence
Deep sequencing
33 reads, 900 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 8198473-8198677 [-]
intergenic
Database links

Mature sequence aly-miR169h-5p

Accession MIMAT0017499
Previous IDsaly-miR169h
Sequence

53 - 

uagccaaggaugacuugccug

 - 73

Get sequence
Deep sequencing31 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR169h-3p

Accession MIMAT0017500
Previous IDsaly-miR169h*
Sequence

140 - 

ggcagucuccuuggcuauu

 - 158

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2