Stem-loop sequence aly-MIR400

AccessionMI0014594 (change log)
DescriptionArabidopsis lyrata miR400 stem-loop
Gene family MIPF0001157; MIR400
Stem-loop
       c      uauauucuu     g     agg    u    -    - ug         g              a a     uau    a 
5' cgac aaaagg         uaauu uucuu   aaga guug aaga u  uuuaugaga uauuauaagucacu c uuugg   gcaa a
   |||| ||||||         ||||| |||||   |||| |||| |||| |  ||||||||| |||||||||||||| | |||||   |||| g
3' guug uuuucu         auuaa aagag   uucu caac uuuu g  aaguacucu auaauauucaguga g aaacc   uguu u
       -      -----uaau     -     aaa    -    g    a gu         a              a c     cuu    u 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 14934184-14934360 [+]
intergenic
Database links

Mature sequence aly-miR400-5p

Accession MIMAT0017583
Previous IDsaly-miR400
Sequence

53 - 

uaugagaguauuauaagucac

 - 73

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR400-3p

Accession MIMAT0017584
Previous IDsaly-miR400*
Sequence

113 - 

gacuuauaauaaucucaugaa

 - 133

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2