Stem-loop sequence aly-MIR831

AccessionMI0014608 (change log)
DescriptionArabidopsis lyrata miR831 stem-loop
Gene family MIPF0001132; MIR831
Stem-loop
   aagug u     aa    u    u                 g   a     aug         u    g     a   guuc   uuu       a 
5'      c acaag  ugua aguc uagagucucaagaagag uac aggag   agaagugaa cacu aaaca gug    ugg   guggauc g
        | |||||  |||| |||| ||||||||||||||||| ||| |||||   ||||||||| |||| ||||| |||    |||   ||||||| u
3'      g uguuc  acau ucag aucuuaggguucuucuc aug uccuc   ucuucacuu gugg uuugu cac    acc   cauuugg a
   -uuua u     --    -    u                 -   c     aaa         c    -     g   -aaa   ---       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348716.1: 2376177-2376361 [+]
intergenic
Database links

Mature sequence aly-miR831-5p

Accession MIMAT0017613
Previous IDsaly-miR831*
Sequence

35 - 

agaagagguacaaggagaugaga

 - 57

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR831-3p

Accession MIMAT0017614
Previous IDsaly-miR831
Sequence

136 - 

uaaacuccucguacucuucuug

 - 157

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2