Stem-loop sequence aly-MIR834

AccessionMI0014610 (change log)
DescriptionArabidopsis lyrata miR834 stem-loop
Gene family MIPF0001183; MIR834
Stem-loop
       ---ag     gccaaaauc     a   u       g         --     uccuuuugaccauu     acc        ---gg    -ca  -  a 
5' uuac     cgaca         accac gcu cugcuac aacguguua  agcca              gcugc   acuauuac     ccau   ca ag a
   ||||     |||||         ||||| ||| ||||||| |||||||||  |||||              |||||   ||||||||     ||||   || || a
3' agug     gcugu         uggug cga gacgaug uugcacagu  ucggu              cggcg   ugauagug     ggug   gu uc a
       cgaua     -------aa     g   u       g         aa     --------------     --a        acaaa    aac  a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348718.1: 3227917-3228096 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR834
aly-MIR834GL348718.1: 3227917-3228096 [-]
aly-MIR162aGL348718.1: 3221153-3221380 [-]
Database links

Mature sequence aly-miR834-5p

Accession MIMAT0017617
Previous IDsaly-miR834*
Sequence

21 - 

accacagcuucugcuacgaac

 - 41

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR834-3p

Accession MIMAT0017618
Previous IDsaly-miR834
Sequence

146 - 

ugguagcaguagcggugguaa

 - 166

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2