Stem-loop sequence aly-MIR845b

AccessionMI0014618 (change log)
DescriptionArabidopsis lyrata miR845b stem-loop
Gene family MIPF0000369; MIR845_1
Stem-loop
   ----agu     cacuag    c   ca     a             a    augau  au 
5'        uccau      guuu cau  cauca uugguaucagagc acgc     gu  a
          |||||      |||| |||  ||||| ||||||||||||| ||||     ||   
3'        aggua      caaa gua  guagu aaccauagucucg ugcg     ca  a
   ucguuau     ------    u   ac     a             c    --aau  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348719.1: 8118257-8118368 [+]
intergenic
Clustered miRNAs
< 10kb from aly-MIR845b
aly-MIR845aGL348719.1: 8114921-8115035 [+]
aly-MIR845bGL348719.1: 8118257-8118368 [+]
Database links

Mature sequence aly-miR845b-5p

Accession MIMAT0017633
Previous IDsaly-miR845b*
Sequence

27 - 

ucaauugguaucagagcaacg

 - 47

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR845b-3p

Accession MIMAT0017634
Previous IDsaly-miR845b
Sequence

70 - 

ucgcucugauaccaaaugaug

 - 90

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2