Stem-loop sequence aly-MIR868

AccessionMI0014629 (change log)
DescriptionArabidopsis lyrata miR868 stem-loop
Gene family MIPF0001173; MIR868
Stem-loop
       -cu     agu  cu  c              u     -c  --acc  c   ----                 u       a a               gag 
5' gaau   guuga   ac  uu ucggcacuugagga gucaa  ug     ag ucu    cguauuucaugucauaa aauaguc c cuagggugauauaac   g
   ||||   |||||   ||  || |||||||||||||| |||||  ||     || |||    ||||||||||||||||| ||||||| | |||||||||||||||   a
3' uuug   uaauu   ug  aa agucgugaauucuu caguu  ac     uc aga    gcauaaaguacaguauu uuguuag g gauccuacuauauug   g
       uau     cuu  -u  u              c     uc  aaaau  a   uuuu                 u       c c               aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348715.1: 8091568-8091775 [+]
intergenic
Database links

Mature sequence aly-miR868-5p

Accession MIMAT0017655
Previous IDsaly-miR868*
Sequence

17 - 

cuuucucggcacuugaggaugu

 - 38

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR868-3p

Accession MIMAT0017656
Previous IDsaly-miR868
Sequence

173 - 

cuucuuaagugcugauaaugu

 - 193

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2