Stem-loop sequence aly-MIR3445

AccessionMI0014661 (change log)
DescriptionArabidopsis lyrata miR3445 stem-loop
Stem-loop
   ---aug   guaaaa   gaua           c               c             c               g  ---------            gug   ga ag  g 
5'       gug      uuu    auugucaccga gggugggucuuucuc cuaucaagcgaac aucaccuuccaaacc uu         cccuucuucuuc   ugg  g  ua u
         |||      |||    ||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||| ||         ||||||||||||   |||  |  ||  
3'       cgc      aag    uaauagugguu cccacccagaaagag gauaguucguuug uaguggaagguuugg aa         gggaagaagaag   acc  u  au c
   uacaga   ---aga   --ag           a               u             u               g  ccucaacac            aaa   ga ga  c 
Get sequence
Deep sequencing
349 reads, 9.7e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348713.1: 7706713-7706931 [-]
intergenic
Database links

Mature sequence aly-miR3445-5p.2

Accession MIMAT0017723
Previous IDsaly-miR3445.2*
Sequence

37 - 

ggucuuucucccuaucaagcg

 - 57

Get sequence
Deep sequencing63 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR3445-5p.1

Accession MIMAT0017724
Previous IDsaly-miR3445.1*
Sequence

56 - 

cgaaccaucaccuuccaaacc

 - 76

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR3445-3p.1

Accession MIMAT0017725
Previous IDsaly-miR3445.1
Sequence

148 - 

uuuggaaggugauuguuugcu

 - 168

Get sequence
Deep sequencing38 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

Mature sequence aly-miR3445-3p.2

Accession MIMAT0017726
Previous IDsaly-miR3445.2
Sequence

167 - 

cuugauagugagaaagaccca

 - 187

Get sequence
Deep sequencing250 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2