Stem-loop sequence aga-mir-998

AccessionMI0033334 (change log)
DescriptionAnopheles gambiae miR-998 stem-loop
Literature search

1 open access papers mention aga-mir-998
(1 sentences)

Stem-loop
   --      c        gu     guauuuaca     c 
5'   gcugaa ucucgugg  cugca         agcgg c
     |||||| ||||||||  |||||         ||||| a
3'   cgacuu agaguacc  gaugu         uugcu c
   cu      -        ac     -------ac     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 13042402-13042472 [+]
intergenic
Clustered miRNAs
< 10kb from aga-mir-998
aga-mir-11chr2R: 13042022-13042111 [+]
aga-mir-998chr2R: 13042402-13042472 [+]
Database links

Mature sequence aga-miR-998-5p

Accession MIMAT0041499
Sequence

1 - 

gcugaacucucgugggucugc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-998-3p

Accession MIMAT0041500
Sequence

51 - 

uagcaccaugagauucagcuc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).