WARNING: This summary was generated by AI. MIRLET7A1 is a gene encoding the microRNA let-7a, which is located on chromosome 9q22.3 and plays a role in gene regulation [PMC5356719]. This microRNA gene was found to be deleted in 49% of the samples in a study investigating deletions of the let-7a cluster, highlighting its potential involvement in genomic alterations [PMC5400605]. However, it is MIRLET7BHG, not MIRLET7A1, that is implicated in auto-regulation as it is targeted by several members of the let-7 family [PMC7961530]. In pediatric patients undergoing treatment for acute lymphoblastic leukemia (ALL), a variant of MIRLET7A1 (rs10739971) was associated with a reduced risk of developing severe hematologic toxicity by 82%, suggesting its potential as a protective factor [PMC10003057]. Additionally, MIRLET7A1 was upregulated to inhibit the expression of the target gene IGF1R, indicating its role in cellular pathways and cancer progression [PMC8840188]. Despite these findings, no significant differences were observed for genotype and allele frequencies between cases and controls for SNPs located near MIRLET7A1 in one study population [PMC4650490]. The gene's involvement extends to cancer and DNA damage response pathways, as it was ranked among the top ten genes related to these processes [PMC6202974].
U uuagg aca c
uggga GAGGUAGUAGGUUGUAUAGUU guc ccca c
||||| ||||||||||||||||||||| ||| ||||
aucCU UUCUGUCAUCUAACAUAUCaa uag gggu a
- ----- --a c
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000062 |
| Description | Homo sapiens hsa-let-7a-5p mature miRNA |
| Sequence | 6 - UGAGGUAGUAGGUUGUAUAGUU - 27 |
| Evidence |
experimental
cloned [1-3,5-8], Northern [1], Illumina [9] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004481 |
| Description | Homo sapiens hsa-let-7a-3p mature miRNA |
| Sequence | 57 - CUAUACAAUCUACUGUCUUUC - 77 |
| Evidence |
experimental
cloned [6] |
| Database links |
|
| Predicted targets |
|
|