miRBase entry: hsa-let-7a-2

Stem-loop hsa-let-7a-2


Accession
MI0000061
Symbol
HGNC: MIRLET7A2
Description
Homo sapiens hsa-let-7a-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7A2 is a microRNA gene that has been observed to be overexpressed in the periprostatic (PP) adipose tissue of patients with endocrine prostate cancer (EPCa), both in overall analyses and specifically within lean and obese/overweight (OB/OW) groups [PMC3523039]. This overexpression is also consistent in OB/OW subjects when compared to benign prostatic hyperplasia (BPH) [PMC3523039]. The gene is situated within a region that expresses several non-coding RNAs and is flanked by binding sites for the regulatory proteins BORIS and CTCF [PMC5650274]. MIRLET7A2 has been included in targeted capture for mutation profiling due to its relevance in cancer research [PMC7815088]. Additionally, MIRLET7A2's promoter region has been reported to show a significant decrease in methylation, which could influence its expression levels [PMC9847511]. Despite its noted expression changes, no significant differences were found for genotype and allele frequencies of MIRLET7A2 between cases and controls in a genotyping study of breast cancer patients [PMC4650490]. The gene's relevance is further highlighted by its inclusion in custom gene panels designed for mutation profiling of pediatric cancers [PMC7341754].

Literature search
1268 open access papers mention hsa-let-7a-2
(7971 sentences)

Sequence

18670398 reads, 37673 reads per million, 153 experiments
agguUGAGGUAGUAGGUUGUAUAGUUuagaauuacaucaagggagauaaCUGUACAGCCUCCUAGCUUUCCu
(((..(((.(((.(((((((((((((.........(((......)))))))))))))))).))).))).)))

Structure
   uU   G   U             uagaauuac   aa 
agg  GAG UAG AGGUUGUAUAGUU         auc  g
|||  ||| ||| |||||||||||||         |||   
uCC  UUC AUC UCCGACAUGUCaa         uag  g
   -U   G   C             ---------   ag 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr11: 122146522-122146593 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7a-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7a-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7a-5p

Accession MIMAT0000062
Description Homo sapiens hsa-let-7a-5p mature miRNA
Sequence 5 - UGAGGUAGUAGGUUGUAUAGUU - 26
Evidence experimental
cloned [1-3,5-8], Northern [1], Illumina [9]
Database links
Predicted targets

Mature hsa-let-7a-2-3p

Accession MIMAT0010195
Description Homo sapiens hsa-let-7a-2-3p mature miRNA
Sequence 50 - CUGUACAGCCUCCUAGCUUUCC - 71
Evidence experimental
qRT-PCR [9]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  4. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  5. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  6. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  7. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  8. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  9. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  10. PubMed ID: 19015728
    MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells
    Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L, Katzenellenbogen M, Ben-Shushan E, Reubinoff BE, Galun E
    PLoS One (2008) 3:e3726