Accession
MI0000061
Symbol
HGNC:
MIRLET7A2
Description
Homo sapiens
hsa-let-7a-2 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIRLET7A2 is a gene that is overexpressed in the PP adipose tissue of patients with prostate cancer (EPCa) [PMC3523039]. It is also overexpressed in the PP adipose tissue of obese/overweight (OB/OW) subjects with cancer compared to benign prostatic hyperplasia (BPH) [PMC3523039]. The MIRLET7A2 locus is located within a region that expresses several non-coding RNAs and is flanked by BORIS and CTCF binding sites [PMC5650274]. The MIRLET7A2 gene can be knocked out using sgRNAs and DICER plasmids [PMC9134915]. Chromosomal loss at 9q22 causes loss of the MIRLET7A gene family, including MIRLET7A2 [PMC7459851]. Methylation levels of CG dinucleotides in the promoter region of MIRLET7A2 can influence its expression [PMC9847511]. MIRLET7A2, along with other miRNA encoding genes, has low expression in murine eyes and is not expressed in ARPE-19 cell lines [PMC9847511]. The custom gene panel for mutation profiling includes MIRLET7A2 for pediatric cancers [PMC7341754]. Certain miRNAs, including MIRLET7A2, are suppressed upon differentiation [PMC4168020]. Deletion rates for MIRLET7A3 are higher than those for MIRLET7A2 and other genes within the let-7a cluster in certain cases [PMC5400605]. No significant differences were found for genotype and allele frequencies of SNPs located near miRNAs including MIRLET7A1 and MIRLET7A2 [PMC4650490].
Literature search
1268 open access papers mention hsa-let-7a-2
(7971 sentences)
(7971 sentences)
Sequence
18670398
reads,
46265
reads per million, 153 experiments
agguUGAGGUAGUAGGUUGUAUAGUUuagaauuacaucaagggagauaaCUGUACAGCCUCCUAGCUUUCCu
(((..(((.(((.(((((((((((((.........(((......)))))))))))))))).))).))).)))
(((..(((.(((.(((((((((((((.........(((......)))))))))))))))).))).))).)))
Structure
uU G U uagaauuac aa agg GAG UAG AGGUUGUAUAGUU auc g ||| ||| ||| ||||||||||||| ||| uCC UUC AUC UCCGACAUGUCaa uag g -U G C --------- ag
Annotation confidence
High
Do you think this miRNA is real?
Genome context
chr11: 122146522-122146593 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7a-2
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-let-7a-2 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-let-7a-5p
| Accession | MIMAT0000062 |
| Description | Homo sapiens hsa-let-7a-5p mature miRNA |
| Sequence | 5 - UGAGGUAGUAGGUUGUAUAGUU - 26 |
| Evidence |
experimental
cloned [1-3,5-8], Northern [1], Illumina [9] |
| Database links |
|
| Predicted targets |
|
Mature hsa-let-7a-2-3p
| Accession | MIMAT0010195 |
| Description | Homo sapiens hsa-let-7a-2-3p mature miRNA |
| Sequence | 50 - CUGUACAGCCUCCUAGCUUUCC - 71 |
| Evidence |
experimental
qRT-PCR [9] |
| Database links |
|
| Predicted targets |
|
References
|
