WARNING: This summary was generated by AI. MIRLET7A2 is a microRNA gene that has been observed to be overexpressed in the periprostatic (PP) adipose tissue of patients with endocrine prostate cancer (EPCa), both in overall analyses and specifically within lean and obese/overweight (OB/OW) groups [PMC3523039]. This overexpression is also consistent in OB/OW subjects when compared to benign prostatic hyperplasia (BPH) [PMC3523039]. The gene is situated within a region that expresses several non-coding RNAs and is flanked by binding sites for the regulatory proteins BORIS and CTCF [PMC5650274]. MIRLET7A2 has been included in targeted capture for mutation profiling due to its relevance in cancer research [PMC7815088]. Additionally, MIRLET7A2's promoter region has been reported to show a significant decrease in methylation, which could influence its expression levels [PMC9847511]. Despite its noted expression changes, no significant differences were found for genotype and allele frequencies of MIRLET7A2 between cases and controls in a genotyping study of breast cancer patients [PMC4650490]. The gene's relevance is further highlighted by its inclusion in custom gene panels designed for mutation profiling of pediatric cancers [PMC7341754].
uU G U uagaauuac aa agg GAG UAG AGGUUGUAUAGUU auc g ||| ||| ||| ||||||||||||| ||| uCC UUC AUC UCCGACAUGUCaa uag g -U G C --------- ag
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000062 |
| Description | Homo sapiens hsa-let-7a-5p mature miRNA |
| Sequence | 5 - UGAGGUAGUAGGUUGUAUAGUU - 26 |
| Evidence |
experimental
cloned [1-3,5-8], Northern [1], Illumina [9] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0010195 |
| Description | Homo sapiens hsa-let-7a-2-3p mature miRNA |
| Sequence | 50 - CUGUACAGCCUCCUAGCUUUCC - 71 |
| Evidence |
experimental
qRT-PCR [9] |
| Database links |
|
| Predicted targets |
|
|