WARNING: This summary was generated by AI. MIRLET7A3 is a gene that encodes for the miR-let-7a microRNA, which is significant due to its well-defined CpG island, suggesting a role in gene regulation through methylation [PMC6353855]. Chromosomal loss at 9q22 has led to the recurrent loss of the MIRLET7A gene family, with MIRLET7A3 experiencing a loss in 21% of cases [PMC7459851]. This gene is frequently deleted in ovarian tumors, with a higher deletion rate observed through FISH analysis compared to CGH [PMC5400605]. Hypermethylation of the MIRLET7A3 CpG island has been associated with transcriptional repression in hepatocellular carcinoma (HCC) and has been reported in various cancers including acute myeloid leukemia and breast cancer [PMC6353855]. The deletion of MIRLET7A3 at chromosomal subband 22q13.31 was found to be the most frequent among ovarian tumors analyzed for let-7a cluster deletions [PMC5400605]. Furthermore, hypermethylation at super-enhancers correlated with microRNA repression including MIRLET7A3 in breast and lung adenocarcinomas [PMC4728783]. The importance of this gene is underscored by its inclusion in custom gene panels designed for mutation profiling of pediatric cancers and its association with regulatory pathways involving IL-6 [PMC7341754; PMC3601972]..
U --------- u ggg GAGGUAGUAGGUUGUAUAGUU uggggc ||| ||||||||||||||||||||| |||||| c ucC UUCUGUCAUCUAACAUAUCaa gucccg U uaggguauc u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000062 |
| Description | Homo sapiens hsa-let-7a-5p mature miRNA |
| Sequence | 4 - UGAGGUAGUAGGUUGUAUAGUU - 25 |
| Evidence |
experimental
cloned [1-3,5-8], Northern [1], Illumina [9] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004481 |
| Description | Homo sapiens hsa-let-7a-3p mature miRNA |
| Sequence | 52 - CUAUACAAUCUACUGUCUUUC - 72 |
| Evidence |
experimental
cloned [6] |
| Database links |
|
| Predicted targets |
|
|