miRBase entry: hsa-let-7a-3

Stem-loop hsa-let-7a-3


Accession
MI0000062
Symbol
HGNC: MIRLET7A3
Description
Homo sapiens hsa-let-7a-3 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIRLET7A3 is a gene that encodes for the miR-let-7a microRNA, which is significant due to its well-defined CpG island, suggesting a role in gene regulation through methylation [PMC6353855]. Chromosomal loss at 9q22 has led to the recurrent loss of the MIRLET7A gene family, with MIRLET7A3 experiencing a loss in 21% of cases [PMC7459851]. This gene is frequently deleted in ovarian tumors, with a higher deletion rate observed through FISH analysis compared to CGH [PMC5400605]. Hypermethylation of the MIRLET7A3 CpG island has been associated with transcriptional repression in hepatocellular carcinoma (HCC) and has been reported in various cancers including acute myeloid leukemia and breast cancer [PMC6353855]. The deletion of MIRLET7A3 at chromosomal subband 22q13.31 was found to be the most frequent among ovarian tumors analyzed for let-7a cluster deletions [PMC5400605]. Furthermore, hypermethylation at super-enhancers correlated with microRNA repression including MIRLET7A3 in breast and lung adenocarcinomas [PMC4728783]. The importance of this gene is underscored by its inclusion in custom gene panels designed for mutation profiling of pediatric cancers and its association with regulatory pathways involving IL-6 [PMC7341754; PMC3601972]..

Literature search
1266 open access papers mention hsa-let-7a-3
(7978 sentences)

Sequence

18710924 reads, 37806 reads per million, 153 experiments
gggUGAGGUAGUAGGUUGUAUAGUUuggggcucugcccugcuaugggauaaCUAUACAAUCUACUGUCUUUCcu
(((.(((((((((((((((((((((((((((...)))))).........))))))))))))))))))))).)))

Structure
   U                     ---------      u 
ggg GAGGUAGUAGGUUGUAUAGUU         uggggc  
||| |||||||||||||||||||||         |||||| c
ucC UUCUGUCAUCUAACAUAUCaa         gucccg  
   U                     uaggguauc      u 


Annotation confidence High
Do you think this miRNA is real?
Comments
let-7a-3p cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
chr22: 46112749-46112822 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7a-3
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7a-3 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7a-5p

Accession MIMAT0000062
Description Homo sapiens hsa-let-7a-5p mature miRNA
Sequence 4 - UGAGGUAGUAGGUUGUAUAGUU - 25
Evidence experimental
cloned [1-3,5-8], Northern [1], Illumina [9]
Database links
Predicted targets

Mature hsa-let-7a-3p

Accession MIMAT0004481
Description Homo sapiens hsa-let-7a-3p mature miRNA
Sequence 52 - CUAUACAAUCUACUGUCUUUC - 72
Evidence experimental
cloned [6]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  4. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  5. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  6. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  7. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  8. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  9. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6