miRBase entry: hsa-let-7a-3

Stem-loop hsa-let-7a-3


Accession
MI0000062
Symbol
HGNC: MIRLET7A3
Description
Homo sapiens hsa-let-7a-3 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7A3 is a gene that belongs to the MIRLET7A gene family, which also includes MIRLET7A1 and MIRLET7A2 [PMC7459851]. It is located at 22q12.31 within the MIRLET7BHG gene [PMC6353855]. The hypermethylation of the MIRLET7A3 gene has been reported in various cancers, including acute myeloid leukemia, ovarian cancer, and breast cancer [PMC6353855]. In hepatocellular carcinoma (HCC), the CpG island in the MIRLET7A3 gene is hypermethylated compared to healthy liver tissue [PMC6353855]. The deletion of the 22q13.31 region where MIRLET7A3 maps is frequently observed in ovarian tumors [PMC5400605]. In breast carcinomas, hypermethylation of the super-enhancer region associated with MIRLET7B and MIRLET7A3 leads to their transcriptional silencing [PMC4728783]. The array Comparative Genomic Hybridization study identified three genes expressing let-7a: MIRLET7A1 on 9q22.3, MIRLET7A2 on 11q24.1, and MIRLET7A3 on 22q13.3 [PMC5356719]. A custom gene panel was designed to include microRNA genes such as MIR100, MIRETLETA1-2-3-B-C-D-E-F-G for mutation profiling of pediatric cancers [PMC7341754]. Mutations in IL6 and LIN28a genes were also investigated but no mutations were found in these genes associated with IL-6 regulatory pathway [PMC3601972].

Literature search
1266 open access papers mention hsa-let-7a-3
(7978 sentences)

Sequence

18712120 reads, 46706 reads per million, 153 experiments
gggUGAGGUAGUAGGUUGUAUAGUUuggggcucugcccugcuaugggauaaCUAUACAAUCUACUGUCUUUCcu
(((.(((((((((((((((((((((((((((...)))))).........))))))))))))))))))))).)))

Structure
   U                     ---------      u 
ggg GAGGUAGUAGGUUGUAUAGUU         uggggc  
||| |||||||||||||||||||||         |||||| c
ucC UUCUGUCAUCUAACAUAUCaa         gucccg  
   U                     uaggguauc      u 


Annotation confidence High
Do you think this miRNA is real?
Comments
let-7a-3p cloned in [6] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
chr22: 46112749-46112822 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7a-3
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7a-3 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7a-5p

Accession MIMAT0000062
Description Homo sapiens hsa-let-7a-5p mature miRNA
Sequence 4 - UGAGGUAGUAGGUUGUAUAGUU - 25
Evidence experimental
cloned [1-3,5-8], Northern [1], Illumina [9]
Database links
Predicted targets

Mature hsa-let-7a-3p

Accession MIMAT0004481
Description Homo sapiens hsa-let-7a-3p mature miRNA
Sequence 52 - CUAUACAAUCUACUGUCUUUC - 72
Evidence experimental
cloned [6]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  4. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  5. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  6. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  7. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  8. PubMed ID: 17989717
    Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis
    "Marton S, Garcia MR, Robello C, Persson H, Trajtenberg F, Pritsch O, Rovira C, Naya H, Dighiero G, Cayota A"
    "Leukemia (2008) 22:330-338

  9. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6